Application of rice heat stress transcription factor in novel variety cultivation

A transcription factor and heat stress technology, applied in the field of plant breeding, can solve the problems of forced ripening under high temperature and sharp drop in yield

Inactive Publication Date: 2011-07-27
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Heat stress is an environmental factor that many plants must face every day in high-temperature summer. Although rice is a temperature-loving crop, rice is very sensitive to high temperature during the flowering and filling stages, and it is easy to form "high temperature forced ripening" and cause a sharp drop in yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of rice heat stress transcription factor in novel variety cultivation
  • Application of rice heat stress transcription factor in novel variety cultivation
  • Application of rice heat stress transcription factor in novel variety cultivation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1, the construction of plant expression vector

[0029] Using pCAMBIA1302-FLAG (XF0349) as a template, use the following primers to amplify the full-length fragment of FLAG, use KpnI and BamHI to singly cut the PCR product and pCAMBIA2302-Ubiqutin-ocs (XF0422), and ligate to obtain pCAMBIA2302-Ubiqutin after recovery - FLAG (XF0426) rice overexpression vector. The sequence containing FLAG after amplification: GGTACCATGGACTACAAGGACGATGATGACAAGGGCGACTATAAGGATGACGACGATAAGACTAGTCCCGGGACGCGTGGATCC

[0030] Using primers P1: 5'-GCGTCTAGA ATGGATGATCCAATGCTGAATGCG-3' and P2: 5'-ATAAGATTCTATTCCCCAGCCGTTGGGCCATT-3' (containing XbaI and BglII recognition sites) to amplify the corresponding osHsfA2b full-length cDNA gene from rice cDNA, using XbaI and BglII The vector XF0426 was digested, linked with T4 DNA ligase, and the ligated product was transformed into Escherichia coli JM109. Resistant colonies were screened on the corresponding resistance plate, and PCR identifi...

Embodiment 2

[0031] Embodiment 2, detection of transgenic plant strain Southern

[0032]The total DNA of the leaves of OsHsfA2b transgenic rice plants and non-transgenic rice plants cultivated at room temperature were extracted respectively, and a conserved sequence of OsHsfA2b DNA was selected as a probe, and rice genomic DNA was digested by BglII and EcoRV double enzymes. The Southern method was used to detect the number of OsHsfA2b gene inserted into the rice genome. The result is as figure 2 As shown, the number of insertions of the OsHsfA2b gene in the 5 different transgenic lines was all single copy.

Embodiment 3

[0033] Embodiment 3, transgenic plant strain Noutern detection

[0034] Total RNA was extracted from leaves of OsHsfA2b transgenic rice plants and non-transgenic rice plants cultured at room temperature, and a conserved sequence of OsHsfA2b DNA was selected as a probe to detect the expression of OsHsfA2b gene by Northern method. The result is as image 3 As shown, it shows that the OsHsfA2b gene expression level of some OsHsfA2b gene plants is significantly higher than that of non-transgenic plants at room temperature. image 3 Among them, the OsHsfA2b gene expression level of OE-8, OE-15 and OE-18 was significantly higher than that of the control wild-type Nipponbare (CK).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a rice heat stress transcription factor OsHsfA2b in late-maturing and high-quality variety cultivation with seed storage tolerance. In the invention, an inventor finds that a mutant strain is flowered later than a wild type plant respectively under the long-day, short-day and mid-day conditions through constructing the rice mutant strain of the over-expressed OsHsfA2b, the seed germination and sprouting of the mutant strain are restricted and even the mutant strain has no sprouting capability. According to the result, an available novel gene resource is provided for a novel rice variety with late maturity, high quality and seed storage tolerance.

Description

technical field [0001] The invention relates to plant breeding, in particular to the application of rice heat stress transcription factor OsHsfA2b in cultivating late-maturing high-quality and storage-resistant plant varieties. Background technique [0002] With the improvement of people's living standards, people's requirements for food quality are getting higher and higher, and cultivating new high-quality rice varieties has become an urgent task for scientific researchers. As we all know, the quality of rice is positively correlated with the growth period to a certain extent, and prolonging the growth period is one of the ways to achieve high rice quality. At the same time, with global warming, the available accumulated temperature of rice in many areas of our country is increasing, which provides good natural conditions for us to cultivate new late-maturing rice varieties. Therefore, elucidating the molecular mechanism of late rice maturation and isolating and identifyi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N1/15C12N1/19C12N1/21A01H5/00A01H5/10
Inventor冯明姬刘春艳储成才李杭序亓建飞曹晓风
OwnerINST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI