Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of EB virus miR-BART3 antisense oligonucleotides in preparing medicament for treating nasopharyngeal darcinoma

An oligonucleotide, mir-bart3 technology, applied in gene therapy, drug combination, anti-tumor drugs, etc., to achieve the effect of prolonged action time, high transfection efficiency, and high specificity

Inactive Publication Date: 2011-09-21
SOUTHERN MEDICAL UNIVERSITY
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Importantly, so far, there is still no report on the role of Epstein-Barr virus miR-BART3 and other Epstein-Barr virus miRNAs in promoting the development of nasopharyngeal carcinoma, especially the invasion and metastasis of nasopharyngeal carcinoma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of EB virus miR-BART3 antisense oligonucleotides in preparing medicament for treating nasopharyngeal darcinoma
  • Application of EB virus miR-BART3 antisense oligonucleotides in preparing medicament for treating nasopharyngeal darcinoma
  • Application of EB virus miR-BART3 antisense oligonucleotides in preparing medicament for treating nasopharyngeal darcinoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] 1. Preparation of nasopharyngeal carcinoma cell line CNE1 containing Epstein-Barr virus miR-BART3;

[0032] cell:

[0033] CNE1 cell line: purchased from Central Laboratory of Xiangya School of Medicine, Central South University, Hunan.

[0034] Preparation of CNE1 cells overexpressing miR-BART3: chemically synthesized Epstein-Barr virus miR-BART3 precursor molecule sequence (282bp), connected to the lentiviral vector pMAGic 4.0 containing GFP expression, passed pNL-EGFP / CMV / WPREDU3 vector plasmid, pCD / NL-BH*DDD packaging plasmid and pLTR-G plasmid were packaged in 293T cells to produce lentiviral vector pMAGic-EB virus miR-BART3 capable of expressing Epstein-Barr virus miR-BART7. The nasopharyngeal carcinoma cell line CNE1 was transfected with this lentiviral vector, and the CNE1 (including GFP expression) with stable and high expression of Epstein-Barr virus miR-BART3 was confirmed by flow cytometry and quantitative PCR. For specific steps, please refer to the lite...

Embodiment 2

[0046] 1. Preparation of Nanospheres

[0047] 1.1 Preparation of polyethyleneimine-coated gold nanoparticles

[0048] Add the thiol-containing gold nanoparticles into NaCl solution with a concentration of 1mM to adjust the concentration of gold nanoparticles to 0.1mg / mL; add polyethyleneimine (PEI, Mw=2k) to the reaction solution until the concentration of polyethyleneimine is 1.0mg / mL mL, react at room temperature for 30 minutes, centrifuge at 157500xg for 10 minutes, and repeat twice to prepare polyethyleneimine-coated gold nanoparticles; resuspend polyethyleneimine-coated gold nanoparticles in 10mM NaCl solution to obtain 0.1mg / mL Polyethyleneimine wrapped nano-gold NaCl solution, stand-by;

[0049] Wherein the gold nanometer containing mercapto group can be prepared according to the following method:

[0050] Take 100mL chloroauric acid aqueous solution (0.01%), heat to boiling, accurately add 2mL of 1% trisodium citrate aqueous solution under stirring, the golden chloro...

Embodiment 3

[0076] Take 40 mg of nanospheres prepared in Example 1 and mix with 500 μl of 10 mM sterile NaCl aqueous solution, add appropriate amount of preservatives and stabilizers, and prepare injections.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Particle sizeaaaaaaaaaa
Particle sizeaaaaaaaaaa
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a medical application of EB (Epstein-Barr) virus miR-BART3 antisense oligonucleotides, in particular relating to an application of EB virus miR-BART3 antisense oligonucleotides in preparing a medicament for treating nasopharyngeal darcinoma, wherein the sequence of the EB virus miR-BART3 antisense oligonucleotides is ACACCUGGUGACUAGUGGUGCG (SEQ ID NO:1). The EB virus miR-BART3 antisense oligonucleotides can be effectively combined with mature miRNA of the EB virus to block the expression of the miRNA and corresponding regulation action thereof, thus restraining the invasion and metastasis of nasopharyngeal darcinoma cells; and the miRNA has no immunogenifcity, thus being favorable for being further applied in preventing the recurrence and metastasis of the nasopharyngeal darcinoma. The medicament can be used for protecting the antisense oligonucleotides from being degraded by nuclease and prolonging the action time, has higher transfection effciciency than that of commodity liposome, and is favorable for further practical clinical development and application.

Description

technical field [0001] The present invention belongs to the field of compounds containing two or more single nucleotide units, in particular to compounds having individual phosphate or polyphosphate groups linked by nucleoside saccharide groups. Background technique [0002] Nasopharyngeal carcinoma (NPC) is a common head and neck malignant tumor in southern my country. It is the disease with the highest recurrence and metastasis rate among head and neck tumors. The cervical lymph node metastasis rate is as high as 80%. 30% of patients have recurrence and metastasis of nasopharyngeal carcinoma, which is one of the main factors leading to clinical death. Traditional treatment methods such as surgery, radiotherapy or chemotherapy are not effective in preventing the recurrence and metastasis of nasopharyngeal carcinoma. , the application of biological therapy is more suitable for the second stage of treatment, in which gene therapy has more important clinical significance for the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00A61K31/7088A61K47/32A61K47/02A61P35/00
Inventor 李欣王莺蔡红兵叶艳芬
Owner SOUTHERN MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com