52results about How to "Inhibition of invasion and metastasis" patented technology

This invention involved oncolytic adenovirus mutant with the multiple antitumoral Mec. It belongs to the BME field. The adenovirus mutant Elb-55kDa and Elb-19kDa has missing gene, inserts chimeric promoter composed by the human telomerase reverse transcriptase core sequence and human tumor epidermal growth factor receptor enhancer before the replication required gene Ela codons mEla289R and mEla243R. So the virus can specific proliferate in cancer cell. Oncolytic viruses and mEla protein can exert thire influence. It can also increase the sensitivity of cancer cell to chemoradiation and have no influence to normal cell. It inserts the human h-endostatin gene expression cassette in adenovirus mutant gene group; along the replication of virus in cancer cell to amplificate h-endostatin gene and effective expression in tumor so to restrain neovascularization of tumor so to realize the result of restrain the increase and transformation of cancer cell and apoptotic cell. This new oncolytic adenovirus mutant has good clinical prospect in gene curing so to used in curing many kinds of human tumors.

The invention provides a novel high-affinity completely humanized antibody which can specifically bind with CD26 as well as a preparation method and application thereof and belongs to the technical field of genetic engineering antibodies. The CD26 is a ubiquitous multifunctional II type transmembrane glycoprotein, has various biological functions and can be interacted with various proteins such as ADA, CD45, FAP-alpha and the like. The invention provides the humanized antibody or a fragment thereof, wherein the antibody or the fragment thereof is capable of specifically binding with the human CD26, preferably the CD26 extracellular domain; the amino acid sequence of the antibody or the fragment thereof comprises an amino acid sequence containing a monoclonal antibody or a fragment thereof or a conjugate of the fragment in any one of 6 complementary determining regions in one of SED ID NO: 2, SED ID NO: 3, SED ID NO: 4, SED ID NO: 6, SED ID NO: 7, and SED ID NO: 8, or an amino acid sequence obtained through amino acid replacement or modification. The obtained anti-CD26 single-chain antibody provided by the invention can highly specifically bind with the CD26 and is simultaneously capable of obviously inhibiting the proliferation, the invasion and the metastasis of tumor cells.

A polypeptide M204C4 for suppressing the activity of gelatinase A (MMP-2) is composed of the amino acid sequence shown by HNWTRWLLHPDRGGGS is disclosed. It can also suppress the invasion and transfer of external pancreas cancer cells PANC01 and CFPAC-1. Its preparing process includes such steps as affinity screening and reproduction of bacteriophage several times to obtain the bacteriophage with specific binding to MMP-2, coating, cloning and monoclonal screening with fluorescent screening reagent kit.

The invention discloses a snake venom metal protease inhibitor BJ46a capable of resisting attack and transference of tumor and application thereof, and belongs to the field of medical organism. In the invention, according to the BJ46a gene sequence (AF294836) in GenBank, the BJ46a full gene is designed and synthesized. An expression vector cloned to baculovirus can generate the recombined BJ46a protein capable of inhibiting the activity of the substrate metal protease in Sf9 insect cells, and in vivo and in vitro experiments show that the BJ46a protein has the functions of resisting the attack and transference of melanoma cells B16. The inhibitor adopts the genetic transfection technique, and can establish B16/pcDNA3.1HisC-BJ46a cell strains with stable transfection, and the in vivo and in vitro experiments prove that the BJ46a can inhibit the attack and transference of B16 cells at the gene level. The inhibitor is applied to preventing and treating the attack and transference of tumor, and has great application prospect.

The invention relates to an application of a PNO1 inhibitor to preparation of esophagus cancer treatment medicines, belongs to the field of biopharmaceutical research, and particularly relates to an application of a PNO1 inhibitor to preparation of esophagus cancer treatment medicines. The inventor firstly finds that the PNO1 can be used as an esophagus cancer treatment target point. The PNO1 inhibitor can restrain the proliferation rate of esophagus cancer cells, can restrain the cloning and forming capacity of the esophagus cancer cells, can promote esophagus cancer apoptosis, can restrain esophagus cancer cell migration, can restrain esophagus cancer cell transfer, and can restrain esophagus cancer cell invasion and transfer, so as to treat esophagus cancer, and a new direction is opened up for treatment of esophagus cancer.

A recombinant fusion protein able to resist against tumor invasion and transfer is composed of the recombinant urokinase fragment and type-2 mutant as plasminogen activator inhibitor. The fusion protein gene cDNA is amplified by PCR method, and is cloned to expression vector to obtain fusion gene expression plasmid, which is used to transform host bacteria. The methanol or temp can induce the expression of said fusion protein. After purified, a high-purity (95%) expression product is obtained.

The invention provides application of Nifeviroc in preparing an antitumor drug, and provides an antitumor drug containing Nifeviroc. As is proved by cell experiments, after Nifeviroc acts on tumor cells, the cell cycle progress can be interfered, and the cell growth is inhibited, so that the cell cycle is stagnant at the G0-G1 stage; meanwhile, cell apoptosis can also be induced by increasing theactive oxygen content in the cells and lowering the mitochondrial membrane potential; meanwhile, Nifeviroc has an obvious effect of inhibiting invasion and metastasis of the tumor cells, by inhibitingadhesive power of the tumor cells to an extracellular matrix, the directed migration capability, the non-targeted migration capability and the in-vitro invasion capability of the cells are lowered, and the increase in size of the tumors in vivo can also be inhibited. As can be seen, Nifeviroc has a good effect of resisting the activity of the tumor, can be used for preparing the antitumor drug, does not have an obvious side effect, and has a good application prospect.

The invention relates to a hydroxyl-enriched nano gene vector as well as a preparation method and application thereof. The vector adopts pentaerythritol as a core, has four arms and is of a star-shaped structure, and the arms have equal molecular weights. The invention discloses the nano gene vector based on a star-shaped polycation derivative (s-PGEA-FA) for a first time, lateral group of the nano gene vector comprises FA ligand and/or rich hydrophilic hydroxyl and secondary amine groups, and the vector is synthesized through atom transfer radical polymerization, ring-opening reaction and amidation reaction, is capable of mediating efficient delivery of miR-101 and miR-217 in different esophagus cancer cell systems, is capable of efficiently silencing the expression of lncRNA MALAT1 and furthermore killing esophagus cancer cells and inhibiting invasion and metastasis of the esophagus cancer cells, and has wide application prospects in treatment on esophagus cancer.

The invention discloses application of atractylon shown as a structural formula (I) to preparation of an anti-liver cancer molecular target medicine. Seen from results of cell experiments and animal experiments provided by the invention, the atractylon has the property and the effect of inhibiting invasion and metastasis of liver cancer cells, which are found by the invention for the first time; in addition, the animal experiments further prove that the atractylon has the function of inhibiting growth of liver tumors in a nude mouse, has a significant anti-tumor effect on the nude mouse, and reaches an unexpected technical effect in the field. These results indicate that the atractylon can be applied to preparation of the anti-liver cancer molecular target medicine and has good applicationprospect and good application value.

The invention relates to a medicinal use of an epstein-barr virus (EBV) miR-BART1-5p antisense oligonucleotide, in particular to the use of the EBV miR-BART1-5p antisense oligonucleotide in preparing drugs for treating nasopharyngeal carcinoma (NPC). A sequence of the antisense oligonucleotide is CACAGCACGUCACUUCCACUAAGA (SEQ ID NO:1). With the present invention, the antisense oligonucleotide can be effectively bound with mature miRNA of the EBV to block an expression of the mature miRNA and a corresponding regulatory effect such that an invasion and a metastasis of NPC cells are inhibited, and the miRNA has no immunogenicity so as to facilitate further use for prevention and cure of recurrence and metastasis of the NPC. According to the drugs prepared through the antisense oligonucleotide provided by the present invention, the antisense oligonucleotide can be protected from a degradation through nuclease, action time can be prolonged, a higher transfection efficiency of the antisense oligonucleotide than the transfection efficiency of commercial liposomes is provided so as to facilitate further practical clinic development and application.

The invention discloses a multifunctional bionic HA particles loaded curcumin prodrug micro-nano composite material, a preparation method and an application thereof. The method comprises the followingsteps, preparing hydroxyapatite micro-nano particles with a bionic structure; preparing a curcumin nano prodrug; adding hydroxyapatite powder and the curcumin nano prodrug into water, uniformly mixing the mixture, and carrying out incubating, adsorbing, centrifuging, freeze-drying and sterilizing to obtain the composite micro-nano particles. The prepared composite micro-nano particles of the present invention have high drug loading capacity, a selective targeting function, good biocompatibility and no obvious toxic or side effect on living organisms. In high drug loading capacity, the composite particles can effectively inhibit growth of bone tumors. In minor drug loading capacity, the micro-nano multistage structure of the composite particles can efficiently promote regeneration and repair of bone tissues.

The invention discloses an application of skeleton protein source polypeptide in preparing medicines for restraining the invasion and the transfer of colorectal cancer cells. The V+Repeat fused polypeptide has very obvious restraining action on the invasion and the transfer of the colorectal cancer.

The invention discloses a polynucleotide for tumor treatment. The polynucleotide comprises an MR fragment shown in SEQ ID NO.1 or further comprises an AMFR fragment shown in SEQ ID NO.2, wherein, theMR segment is a 565 bp nucleotide sequence, and the AMFR segment is a 293 bp nucleotide sequence. Both chemical synthesis and targeted gene editing technologies have the characteristics of simple operation and strong feasibility. The individual MR fragment, or AMFR fragment, and GMAN-AS containing the MR fragment and the AMFR fragment can significantly inhibit the invasion of gastric cancer cells,so that the polynucleotide has important potential for treating gastric cancer metastasis.

The invention relates to biscuits rich in zinc and selenium elements. The biscuits comprise the following components in parts by weight: 42-50 parts of selenium-enriched red rice flour, 15-17 parts of selenium-enriched Chinese yam powder, 5-6 parts of longan, 12-15 parts of milk powder, 4-6 parts of syrup, 8-10 parts of peanut oil, 1-1.2 parts of vitamins and mineral substances, 2-3 parts of a swelling agent and 1-1.8 parts of table salt. Compared with the prior art, the biscuits disclosed by the invention are good in mouth feel, rich in various elements, beneficial to digestion, rich in nutrition and simple to make, and cannot enable people to feel dried when being eaten.

The invention discloses a gold nano composite material of a high target tumor, and a preparation method and application of the gold nano composite material. The gold nano composite material is prepared from doxorubicin, AMD3100, double-chain DNA (deoxyribonucleic acid), PEG (polyethylene glycol) and gold nano particles; the doxorubicin is loaded on the double-chain DNA, and the AMD3100 is modified on the PEG; and the double-chain DNA and the PEG are connected onto the gold nano particles by virtue of sulfydryl. According to the gold nano composite material of the high target tumor, the anticancer drug doxorubicin is used for achieving a chemotherapy effect on tumor cells, and a small molecular inhibitor AMD3100 can be combined with a CXCR4 receptor highly expressed on the surface of the tumor cells in a targeting way. Since the AMD3100 can be combined with and can lower the expression of the CXCR4 and can also inhibit the invasion transfer of the tumor, the combination of the AMD3100 and the CXCR4 can effectively improve an effect for killing the liver cancer, can reduce the consumption of the doxorubicin, and can reduce the toxicity and adverse effect for the normal cells by specifically targeting a liver cancer tissue.

The invention discloses a long-acting acne removal skincare composition. The long-acting acne removal skincare composition comprises, by weight, 0.1-10 parts of ononis spinosa, 0.1-10 parts of viscumcoloratum, 0.1-10 parts of carica papaya, 0.1-10 parts of drynaria fortunei and 0.1-10 parts of trigonella foenum-graecum. The long-acting acne removal skincare composition has the advantages that various medicines are used with one another, synergistic effects can be realized, abnormal hormone secretion can be regulated, the internal ecological balance of hair follicles can be regulated, accordingly, acne can be removed in a long-acting manner, and the problem of recurrent attack of acne can be solved by the aid of the acne removal skincare composition.

The invention discloses application of a substance for inhibiting the expression of ZNF8 protein in preparing products for preventing and treating cancer. An experiment shows that the ZNF8 protein canbe bound with p53 protein; by inhibiting the expression of the ZNF8 protein, the transcription activity of the p53 protein can be increased, the expressions of a VEGF gene and an ANGPLT4 gene are reduced, and proliferation, metastasis, migration, invasion and metastasis of tumor cells are inhibited; the formation of blood vessels is inhibited; the growth,the metastasis and lung metastasis of thetumor are inhibited; the survival rate of tumor-carrying animals is improved. Therefore, inhibition of the expression of the ZNF8 protein has important application value in inhibiting the growth and invasive metastasis of the tumor. Cancer can be prevented and/treated by inhibiting the expression of the ZNF8 protein.

The invention discloses an application of recombinant FN heparin binding domain polypeptide on preparing medicaments resisting the invasion and the metastasis of malignant tumors. The recombinant FN heparin binding domain polypeptide comprises five I type homologous structures at the end N in FN molecules and contains 237 amino acids in Ser46-Gly 282. DNA sequences for encoding the polypeptide range from 403bp to 1113bp and have the length of 711bp, a PCR amplified fragment has the length of 741bp, and the length of the fragment after double enzyme digestion is 729bp. The molecular weight of the polypeptide expressed by yeast is 28.52kDa, and the polypeptide comprises three III type homologous structures in the FN molecules, i.e. III-12, III-13 and III-14 and contains 272 amino acids in Tyr1720-Tyr1991. DNA sequences for encoding the polypeptide range from 5428bp to 6244bp and have the length of 816bp, a PCR amplified fragment has the length of 835bp, and the length of the fragment after double enzyme digestion is 828bp. The molecular weight of the polypeptide expressed by the yeast is 36.09kDa. The experiments prove that the recombinant FN heparin binding domain polypeptide can be applied to preparing medicaments resisting the invasion and the metastasis of malignant tumors.

The invention discloses application of pueraria flower spleen-strengthening-relieving formula drug-containing serum in cancer cells. By preparing the pueraria flower spleen-strengthening-relieving formula drug-containing serum, observing the influence of the drug-containing serum with different concentrations on the invasion, transfer and epithelial-mesenchymal transition of HepG2 hepatoma carcinoma cells and observing the influence of the drug-containing serum with different concentrations on the proliferation and apoptosis of the HepG2 hepatoma carcinoma cells, the pueraria flower spleen-strengthening-relieving formula drug-containing serum is proved to have the effects of inhibiting the proliferation of the HepG2 hepatoma carcinoma cells, promoting the apoptosis of the HepG2 hepatoma carcinoma cells and the like, and theoretical and data support is provided for the clinical anti-hepatoma metastasis application of the formula.

The invention discloses an agastache rugosus plant fermentation solution and a preparation method thereof and relates to the technical field of fermentation solutions. The agastache rugosus plant fermentation solution comprises the following components: 5-7 parts of dry agastache rugosus, 5-7 parts of dry fructus amomi rotundus, 5-7 parts of dry fructus crataegi, 0.5-1 part of honey, 0.5-1 part of oligosaccharide, 0.5-1 part of glucose powder, 0.02-0.04 part of dry yeast and 50 parts of water. The preparation method of the agastache rugosus plant fermentation solution comprises the following steps: crushing the dry agastache rugosus, the dry fructus amomi rotundus and the dry fructus crataegi, then blending crushed dry agastache rugosus, dry fructus amomi rotundus and dry fructus crataegi with the honey, the oligosaccharide, the glucose powder and the dry yeast according to a ratio by using the water, adding the materials into a tank, sealing and fermenting until vinegar flavor is emitted, then processing, extracting and purifying a fermentation solution by using a supercritical fluid extraction separation technology to obtain the agastache rugosus plant fermentation solution. The fermentation solution is formed by fermenting pure traditional Chinese medicines, has vinegar flavor, is delicious with slight sweetness and sour, is good in taste, is popular to children, and is free of side effects after being taken. Clinical test shows that the fermentation solution is used for treating anorexia; the curative effect is obvious; the total effective rate is 95%.

The invention discloses a small peptide with a function of inhibiting liver cancer metastasis as well as a preparation method and application of the small peptide. The small peptide has amino acid sequences shown as SEQ ID NO.1-4 or a sequence which is obtained by substituting, deleting and/or adding one or more amino acids to any one of the amino acid sequences shown as SEQ ID NO.1-4 and/or has afunction of inhibiting liver cancer metastasis after terminal modification. The invention further provides the preparation method of the small peptide, and an amino acid site mediating rapid degradation of the small peptide is obtained. The small peptide is found to have the function of inhibiting invasion and metastasis of liver cancer cells, is strong in capacity of inhibiting migration of theliver cancer cells, and has the application potential of developing novel liver cancer cell metastasis resisting drugs or other preparations.