Tumour-dissolving adenovirus mutant possessing multiple specific anti-tumour mechanism
An oncolytic adenovirus, specific technology, applied in the fields of biomedicine and life sciences, can solve the problems of non-targeting, poor safety, low efficiency of anti-cancer genes, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Construction of Adenoviral Vectors Controlling mE1a289R and mE1a243R by Tumor-specific Chimeric Promoters
[0048] The first step: clone the tumor-specific chimeric promoter, insert it into the NheI+XhoI site of the plasmid pIRES, and construct the vector pSu-1 containing the tumor-specific chimeric promoter. pIRES was purchased from Clontech Laboratories, USA. The designed tumor-specific chimeric promoter has a full length of 696 bp and its sequence is as follows:
[0049]ctagcagatctgcagggtgcgagacccaggcagaaacattttgctggatgaggaggaaagatgtaaggttgctccccttcagagacagcaaagggcaggtctgtagcttcacttacttcaggattgtgatttttgacagagccgagagatcagggttgttgaaccaggcctgaaggtcctagtgaatctcgtgaagagaggaggggtctggctgtaacatggacctagaggacatttttactgcaggagaaggaacagtggggatggggtggacttgccaaaggaatatagctcaagttcctgcagcccaaaaaagctcagtttcttttggccaaagcttcgcgcgggcggggaagcgcggcccagaccccgcggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggatctcacagacgcccaggaccgcgcttcccacgtggcggagggactggggacccgggcacccgtcctgcccctt...
Embodiment 2
[0063] Construction of Adenoviral Vector Carrying Deletion of E1 Region of Human Endostatin Gene
[0064] The first step: cloning and obtaining the human endostatin (endostatin) gene sequence, adding the M-oncogenesis protein signal peptide coding sequence in front, and its function is to make the expressed endostatin protein have an exocrine function. The full length of the gene fragment is 636bp, and the sequence is as follows:
[0065] aattcaccatgggggtactgctcacacagaggacgctgctcagtctggtccttgcactcctgtttccaagcatggcgagccacagccaccgcgacttccagccggtgctccacctggttgcgctcaacagccccctgtcaggcggcatgcggggcatccgcggggccgacttccagtgcttccagcaggcgcgggccgtggggctggcgggcaccttccgcgccttcctgtcctcgcgcctgcaggacctgtacagcatcgtgcgccgtgccgaccgcgcagccgtgcccatcgtcaacctcaaggacgagctgctgtttcccagctgggaggctctgttctcaggctctgagggtccgctgaagcccggggcacgcatcttctcctttaacggcaaggacgtcctgaggcaccccacctggccccagaagagcgtgtggcatggctcggaccccaacgggcgcaggctgaccgagagctactgtgagacgtggcggacggaggctccctcggccacgggccaggcctcctcgctgctggggggcaggc...
Embodiment 3
[0068] Construction of Oncolytic Adenoviral Vector Carrying Human Endostatin Gene
[0069] After pCA13-hE was digested with BglII, the fragment containing the complete expression cassette of the human endostatin gene was recovered and inserted into the pSu-4 / BglII site to construct an oncolytic adenoviral vector pSu-hE carrying the human endostatin gene.
[0070] The complete expression cassette of the human endostatin gene contained in pCA13-hE is 1217bp in length, and its sequence is as follows:
[0071]gatctaattccctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctggggatcagtcttcgagtcgacaagcttgaattcaccatgggggtactgctcacacagaggacgctgctcagtctggtccttgcactcctgtttccaagca...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap