Tumour-dissolving adenovirus mutant possessing multiple specific anti-tumour mechanism

An oncolytic adenovirus, specific technology, applied in the fields of biomedicine and life sciences, can solve the problems of non-targeting, poor safety, low efficiency of anti-cancer genes, etc.

Inactive Publication Date: 2010-01-20
JIANGSU SHUNTANG BIOENG
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide an oncolytic adenovirus mutant with multiple specific anti-cancer mechanisms that has good clinical application prospects and can be used for the treatment of various tumors. The oncolytic virus and anti-cancer gene recombinants overcome the current replication Defective adenoviral vectors (such as Ad-p53) have the disadvantages of low efficiency and no targeting of anti-cancer gene transfer and expression, and overcome the shortcomings of proliferative and replicative adenoviral vectors (such as H101, ONYX-015) which only have a single anti-tumor mechanism and are safe. Poor sex and other shortcomings, its anti-tumor efficacy can be improved, and the safety can be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumour-dissolving adenovirus mutant possessing multiple specific anti-tumour mechanism

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Construction of Adenoviral Vectors Controlling mE1a289R and mE1a243R by Tumor-specific Chimeric Promoters

[0048] The first step: clone the tumor-specific chimeric promoter, insert it into the NheI+XhoI site of the plasmid pIRES, and construct the vector pSu-1 containing the tumor-specific chimeric promoter. pIRES was purchased from Clontech Laboratories, USA. The designed tumor-specific chimeric promoter has a full length of 696 bp and its sequence is as follows:

[0049]ctagcagatctgcagggtgcgagacccaggcagaaacattttgctggatgaggaggaaagatgtaaggttgctccccttcagagacagcaaagggcaggtctgtagcttcacttacttcaggattgtgatttttgacagagccgagagatcagggttgttgaaccaggcctgaaggtcctagtgaatctcgtgaagagaggaggggtctggctgtaacatggacctagaggacatttttactgcaggagaaggaacagtggggatggggtggacttgccaaaggaatatagctcaagttcctgcagcccaaaaaagctcagtttcttttggccaaagcttcgcgcgggcggggaagcgcggcccagaccccgcggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggatctcacagacgcccaggaccgcgcttcccacgtggcggagggactggggacccgggcacccgtcctgcccctt...

Embodiment 2

[0063] Construction of Adenoviral Vector Carrying Deletion of E1 Region of Human Endostatin Gene

[0064] The first step: cloning and obtaining the human endostatin (endostatin) gene sequence, adding the M-oncogenesis protein signal peptide coding sequence in front, and its function is to make the expressed endostatin protein have an exocrine function. The full length of the gene fragment is 636bp, and the sequence is as follows:

[0065] aattcaccatgggggtactgctcacacagaggacgctgctcagtctggtccttgcactcctgtttccaagcatggcgagccacagccaccgcgacttccagccggtgctccacctggttgcgctcaacagccccctgtcaggcggcatgcggggcatccgcggggccgacttccagtgcttccagcaggcgcgggccgtggggctggcgggcaccttccgcgccttcctgtcctcgcgcctgcaggacctgtacagcatcgtgcgccgtgccgaccgcgcagccgtgcccatcgtcaacctcaaggacgagctgctgtttcccagctgggaggctctgttctcaggctctgagggtccgctgaagcccggggcacgcatcttctcctttaacggcaaggacgtcctgaggcaccccacctggccccagaagagcgtgtggcatggctcggaccccaacgggcgcaggctgaccgagagctactgtgagacgtggcggacggaggctccctcggccacgggccaggcctcctcgctgctggggggcaggc...

Embodiment 3

[0068] Construction of Oncolytic Adenoviral Vector Carrying Human Endostatin Gene

[0069] After pCA13-hE was digested with BglII, the fragment containing the complete expression cassette of the human endostatin gene was recovered and inserted into the pSu-4 / BglII site to construct an oncolytic adenoviral vector pSu-hE carrying the human endostatin gene.

[0070] The complete expression cassette of the human endostatin gene contained in pCA13-hE is 1217bp in length, and its sequence is as follows:

[0071]gatctaattccctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctggggatcagtcttcgagtcgacaagcttgaattcaccatgggggtactgctcacacagaggacgctgctcagtctggtccttgcactcctgtttccaagca...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

This invention involved oncolytic adenovirus mutant with the multiple antitumoral Mec. It belongs to the BME field. The adenovirus mutant Elb-55kDa and Elb-19kDa has missing gene, inserts chimeric promoter composed by the human telomerase reverse transcriptase core sequence and human tumor epidermal growth factor receptor enhancer before the replication required gene Ela codons mEla289R and mEla243R. So the virus can specific proliferate in cancer cell. Oncolytic viruses and mEla protein can exert thire influence. It can also increase the sensitivity of cancer cell to chemoradiation and have no influence to normal cell. It inserts the human h-endostatin gene expression cassette in adenovirus mutant gene group; along the replication of virus in cancer cell to amplificate h-endostatin gene and effective expression in tumor so to restrain neovascularization of tumor so to realize the result of restrain the increase and transformation of cancer cell and apoptotic cell. This new oncolytic adenovirus mutant has good clinical prospect in gene curing so to used in curing many kinds of human tumors.

Description

technical field [0001] The invention relates to an oncolytic adenovirus mutant with multiple specific anticancer mechanisms applied to tumor treatment, belonging to the fields of life science and biomedicine. Background technique [0002] Malignant tumors are a large class of diseases characterized by abnormal cell proliferation and metastasis. In 2000, there were about 10 million new cancer cases worldwide, 6.2 million deaths, and 22 million current cases. The morbidity and mortality of tumors in my country have been on the rise. In 2000, the number of cancer patients was about 1.8-2 million, and the number of deaths was 1.4-1.5 million. Among urban residents, tumors have accounted for the first cause of death. However, with the development of society and economy, the main risk factors of tumors have not been effectively controlled. At present, the treatment of malignant tumors is still dominated by conventional surgery, radiotherapy, and chemotherapy. This conventional t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/861C12N15/33C12N15/12
Inventor 苏长青
Owner JIANGSU SHUNTANG BIOENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products