Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Use of epstein-barr virus miR-BART1-5p antisense oligonucleotide in preparing drugs for treating nasopharyngeal carcinoma

An oligonucleotide and nasopharyngeal carcinoma technology, applied in gene therapy, drug combination, antineoplastic drugs, etc., to achieve high specificity, good recurrence and metastasis, and prolong the effect time

Inactive Publication Date: 2011-10-19
SOUTHERN MEDICAL UNIVERSITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Importantly, so far, there is still no report on the role of Epstein-Barr virus miR-BART1-5p and other Epstein-Barr virus miRNAs in promoting the development of nasopharyngeal carcinoma, especially the invasion and metastasis of nasopharyngeal carcinoma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of epstein-barr virus miR-BART1-5p antisense oligonucleotide in preparing drugs for treating nasopharyngeal carcinoma
  • Use of epstein-barr virus miR-BART1-5p antisense oligonucleotide in preparing drugs for treating nasopharyngeal carcinoma
  • Use of epstein-barr virus miR-BART1-5p antisense oligonucleotide in preparing drugs for treating nasopharyngeal carcinoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] 1. Preparation of nasopharyngeal carcinoma cell line CNE1 containing Epstein-Barr virus miR-BART1-5p

[0033] cell:

[0034] CNE1 cell line: purchased from Central Laboratory of Xiangya School of Medicine, Central South University, Hunan.

[0035] Preparation of CNE1 cells overexpressing miR-BART1-5p: chemically synthesized Epstein-Barr virus miR-BART1-5p precursor molecule sequence (282bp), connected to the lentiviral vector pMAGic 4.0 containing GFP expression, passed pNL-EGFP / CMV / WPREDU3 The vector plasmid, pCD / NL-BH*DDD packaging plasmid and pLTR-G plasmid were packaged in 293T cells to produce a lentiviral vector pMAGic-EBV-miR-BART1-5p capable of expressing Epstein-Barr virus miR-BART1-5p. This lentiviral vector was used to transfect nasopharyngeal carcinoma cell line CNE1, and it was confirmed by flow cytometry and quantitative PCR that CNE1 with stable and high expression of Epstein-Barr virus miR-BART1-5p (including GFP expression) was obtained. For specific ...

Embodiment 2

[0047] 1. Preparation of Nanospheres

[0048] 1.1 Preparation of polyethyleneimine-coated gold nanoparticles

[0049] Add the sulfhydryl-containing gold nanoparticles into NaCl solution with a concentration of 1mM to adjust the gold nanometer concentration to 0.1mg / mL; add polyethyleneimine (PEI, Mw=2k) to the reaction solution until the concentration of polyethyleneimine is 1.0mg / mL mL, react at room temperature for 30 minutes, centrifuge at 157500xg for 10 minutes, repeat twice to prepare polyethyleneimine-coated gold nanoparticles; resuspend polyethyleneimine-coated gold nanoparticles in NaCl solution with a concentration of 10mM to obtain 0.1mg / mL Polyethyleneimine wrapped nano-gold NaCl solution, stand-by;

[0050] Wherein the gold nanometer containing mercapto group can be prepared according to the following method:

[0051] Take 100mL chloroauric acid aqueous solution (0.01%), heat to boiling, accurately add 1% trisodium citrate aqueous solution 2mL under stirring, th...

Embodiment 3

[0077] Take 40 mg of nanospheres prepared in Example 1 and mix with 500 μl of 10 mM sterile NaCl aqueous solution, add appropriate amount of preservatives and stabilizers, and prepare injections.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a medicinal use of an epstein-barr virus (EBV) miR-BART1-5p antisense oligonucleotide, in particular to the use of the EBV miR-BART1-5p antisense oligonucleotide in preparing drugs for treating nasopharyngeal carcinoma (NPC). A sequence of the antisense oligonucleotide is CACAGCACGUCACUUCCACUAAGA (SEQ ID NO:1). With the present invention, the antisense oligonucleotide can be effectively bound with mature miRNA of the EBV to block an expression of the mature miRNA and a corresponding regulatory effect such that an invasion and a metastasis of NPC cells are inhibited, and the miRNA has no immunogenicity so as to facilitate further use for prevention and cure of recurrence and metastasis of the NPC. According to the drugs prepared through the antisense oligonucleotide provided by the present invention, the antisense oligonucleotide can be protected from a degradation through nuclease, action time can be prolonged, a higher transfection efficiency of the antisense oligonucleotide than the transfection efficiency of commercial liposomes is provided so as to facilitate further practical clinic development and application.

Description

technical field [0001] The present invention belongs to the field of compounds containing two or more single nucleotide units, in particular to compounds having individual phosphate or polyphosphate groups linked by nucleoside saccharide groups. Background technique [0002] Nasopharyngeal carcinoma (NPC) is a common head and neck malignant tumor in southern my country. It is the disease with the highest recurrence and metastasis rate among head and neck tumors. The cervical lymph node metastasis rate is as high as 80%. 30% of patients have recurrence and metastasis of nasopharyngeal carcinoma, which is one of the main factors leading to clinical death. Traditional treatment methods such as surgery, radiotherapy or chemotherapy are not effective in preventing the recurrence and metastasis of nasopharyngeal carcinoma. , the application of biological therapy is more suitable for the second stage of treatment, in which gene therapy has more important clinical significance for the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61K47/02A61K47/34A61P35/00
Inventor 李欣王莺蔡红兵叶艳芬
Owner SOUTHERN MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com