Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mutant protein with unnatural amino acids and application thereof

A technology of unnatural amino acids and amino acids, applied in the field of genetic engineering drugs, can solve the problems of limited modification sites of BAFF, high requirements for exogenous fragments, and limited application.

Active Publication Date: 2013-07-03
CHINA PHARM UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The currently commonly used method of adding adjuvants can be used to improve immunogenicity, but the effect of this method is not obvious, and it is difficult to effectively induce the production of specific antibodies; or BAFF can be modified to fuse some exogenous T cell antigens Epitopes, etc. are used to improve immunogenicity. Although this method can produce antibodies, it has high requirements for foreign fragments, and the modification site of BAFF is limited, so its application is limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutant protein with unnatural amino acids and application thereof
  • Mutant protein with unnatural amino acids and application thereof
  • Mutant protein with unnatural amino acids and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] nO 2 Phe 22 Expression, purification and identification of smBAFF

[0043] According to the amino acid sequence information of BAFF (UniProtKB: Q9Y275.1) in the PDB database and referring to the codon preference principle of Escherichia coli, the gene sequence of the prototype protein smBAFF (SEQ ID NO: 6) was designed and sent to Invitrogen for synthesis. Using the prototype protein gene as a template, the amino acid codon at position 22 was mutated into an amber codon TAG using Overlapping PCR technology to synthesize smBAFF 22 (SEQ ID NO: 7). Primers were designed as follows:

[0044] Primer P1 (SEQ ID NO: 11): 5'GGATCCGACGACGACGACAA 3'

[0045] Primer 22P2 (SEQ ID NO: 13): 5'GGTCTAAGAACCCTTTTGGATCGTC3'

[0046] Primer 22P3 (SEQ ID NO: 14): 5'TCTTAGACCTTCGTTCCGTGGCTGC3'

[0047] Primer P4 (SEQ ID NO: 12): 5'CTCGAGTTACAGGAGTTTGA3'

[0048] The synthesized target gene sequence was connected to the vector pMD18-T Simple (TAKARA, purchased from Dalian Biotech), an...

Embodiment 2

[0052] nO 2 Phe 65 Expression, purification and identification of smBAFF

[0053] Using the prototype protein smBAFF (SEQ ID NO: 6) gene as a template, use Overlapping PCR technology to mutate the 65th amino acid codon into an amber codon TAG to synthesize smBAFF 65 (SEQ ID NO: 8). Primers were designed as follows:

[0054] Primer P1 (SEQ ID NO: 11): 5'GGATCCGACGACGACGACAA 3'

[0055] Primer 65P2 (SEQ ID NO: 15): 5'AGCCTACGTCTTGTCGGTGTAGAGC3'

[0056] Primer 65P3 (SEQ ID NO: 16): 5'GCTATGGGCCACCTGATTCAGCGTA3'

[0057] Primer P4 (SEQ ID NO: 12): 5'CTCGAGTTACAGGAGTTTGA3'

[0058] The synthesized target gene sequence was connected to the vector pMD18-T Simple (TAKARA, purchased from Dalian Biotech), and sequenced by Nanjing Sipujin Biotechnology Co., Ltd. to obtain T-smBAFF with the correct sequence 65 . T-smBAFF 65 The vector pET28a (Novagen, purchased from Invitrogen) was digested with BamHI and XbaI respectively, and connected with T4DNA Ligase (TAKARA, purchased from...

Embodiment 3

[0062] nO 2 Phe 119 Expression, purification and identification of smBAFF

[0063] Using the prototype protein smBAFF (SEQ ID NO: 6) gene as a template, the amino acid codon at position 119 was mutated into an amber codon TAG by OverlappingPCR technology to synthesize smBAFF 119 (SEQ ID NO: 9). Primers were designed as follows:

[0064] Primer P1 (SEQ ID NO: 11): 5'GGATCCGACGACGACGACAA3'

[0065] Primer 119P2 (SEQ ID NO: 17): 5'GAGCTAGAGTTCGTCGCCTTCTTCG3'

[0066] Primer 119P3 (SEQ ID NO: 18): 5' CTCTAGCTCGCTATTCCGCGTGAGA 3'

[0067] Primer P4 (SEQ ID NO: 12): 5'CTCGAGTTACAGGAGTTTGA3'

[0068] The synthesized target gene sequence was connected to the vector pMD18-T Simple (TAKARA, purchased from Dalian Biotech), and sequenced by Nanjing Sipujin Biotechnology Co., Ltd. to obtain T-smBAFF with the correct sequence 119 . T-smBAFF 119 The vector pET28a (Novagen, purchased from Invitrogen) was digested with BamHI and XbaI respectively, and connected with T4DNA Ligase (TAKA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetically engineered drugs and relates to a novel BAFF mutant capable of participating in immune adjustment. The BAFF mutant relates to the BAFF mutant expressed through a prokaryotic system and provided with unnatural amino acids. The BAFF mutant can generate antibodies through stimulating an organism to participate in adjusting an immune system, and can be used for preparing medicine for curing autoimmune diseases.

Description

technical field [0001] The invention belongs to the field of genetic engineering drugs, and relates to specifically introducing unnatural amino acids into BAFF and its mutants, and a method for specifically introducing unnatural amino acids into BAFF using a prokaryotic expression system. The mutated BAFF has the ability to regulate the immune system The function can be used in the preparation of medicines for treating autoimmune diseases. Background of the invention [0002] The BAFF involved in the present invention is the 13th member of the tumor necrosis family, which was discovered and successfully cloned in 1999, and is also known as BLyS, TALL-1, THANK, TNFSF20, TNFSF13B, ZTNF4, etc. [1] . BAFF is an important regulator of B cell function in vivo, and promotes the activation, proliferation and maturation of B lymphocytes by binding to its receptor. For example, BAFF interacts with the receptor BCMA to mediate cell survival and proliferation and enhance the antigen p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/525A61K39/00A61P37/02
Inventor 姚文兵黄捷高向东陈超田浤
Owner CHINA PHARM UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com