Protease gene obtained from paecilomyces cicadae and having function of degrading insect body wall and application

A technology of Paecilomyces cicadae and protease, applied in the field of molecular biology and applied microbiology, can solve the problems of poor storage resistance, slow death, sensitive environment temperature and humidity, etc.

Inactive Publication Date: 2013-08-07
ZHEJIANG SUB TROPICS CROP INST
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

A large number of studies have shown that there is an important relationship between the pathogenicity of entomogenic fungi to insects and the enzymes (protease, chitinase, lipase, amylase, etc.) produced during the invasion process. However, Paecilomyces cicadae also has Common problems of fungi, such as sensitivity to environmental temperature and humidity, poor storage resistance, weak environmental adaptability, slow lethality, and unstable control effects, etc., which seriously restrict their application and commercial production in agricultural pest control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protease gene obtained from paecilomyces cicadae and having function of degrading insect body wall and application
  • Protease gene obtained from paecilomyces cicadae and having function of degrading insect body wall and application
  • Protease gene obtained from paecilomyces cicadae and having function of degrading insect body wall and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0019] The present invention is illustrated by the following specific implementation examples, but is not limited to these examples.

[0020] Sequence Analysis of Pr1 Specific Fragment and Cloning of Partial Fragment

[0021] According to the homology comparison of the subtilisin-like gene sequences of Peacilomyces, Isaria, Beauveria bassiana and Metarhizium anisopliae registered in Genebank, a pair of primers were designed based on their highly conserved nucleotide sequences,

[0022] (SEQ ID NO: 1) PCPr1F, 5'CTGGCTTCCGTGGTTATGCTGG3'

[0023] (SEQ ID NO: 2) PCPr1R, 5'CACCACCAAGAGACATGTTGGCGAC3'

[0024] Paecilomyces cicadae (strain APC20 preservation number CGMCC NO: 1104) mRNA was extracted according to conventional methods ( figure 1 ), reverse-transcribed into cDNA by a reverse transcription kit, cDNA was used as a template, and the above-mentioned PCPrF and PCPrR were used as primers, and a clear and single electrophoresis band was obtained by PCR amplification ( figu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses protease gene obtained from paecilomyces cicadae and having a function of degrading an insect body wall, wherein the protease gene is shown in SEQ IN NO: 16; and a protease protein fragment which is obtained from the paecilomyces cicadae and has the function of degrading the insect body wall is provided, wherein the amino acid sequence of the protease is shown in SEQ IN NO: 17. By utilizing the protease gene disclosed by the invention and expressed by genes, the insect body wall can be degraded, and a new idea is provided and a new manner is created for the research on a novel, high-efficiency and safe pesticide.

Description

technical field [0001] The invention relates to a novel subtilisin-like protease gene derived from the entomogenic fungus Paecilomyces cicadae and application thereof, belonging to the fields of molecular biology and applied microbiology. Background technique [0002] Paecilomyces cicadae Miq. is an entomogenic fungus of the genus Paecilomyces isolated from cicada nymph zombies. It is a traditional Chinese medicine in my country - cicadae, which has various medicinal values. Current studies have found that Paecilomyces cicadae is pathogenic to various pests of Lepidoptera, Homoptera and Hymenoptera, so it can be applied to agricultural biological control. With regret comes hope. As the historical production area of ​​Paecilomyces cicadae, Zhejiang, such as Hangzhou, Wenzhou, Lishui, Taizhou, Ningbo and other places have abundant Paecilomyces cicadae resources, therefore, it has a unique advantage to carry out the biological control and research of Paecilomyces cicadae. A l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/57C12N9/58C12N15/10C12R1/79
Inventor 柴一秋陈官菊党向利厉晓腊金轶伟刘又高
Owner ZHEJIANG SUB TROPICS CROP INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap