A microalgal triacylglycerol synthesis regulation gene and its application
A technology of microalgae triacylglycerol and gene regulation, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems of weak molecular mechanism research and scarce research reports
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] The cloning of embodiment 1CrBbox
[0026] 1) Total RNA extraction from Chlamydomonas reinhardtii
[0027] Chlamydomonas reinhardtii (Chlamydomonas reinhardtii) strain CC425, cultivated in a light incubator at 24°C, 100 μmolm -2 sec -1 Under the condition of white light and full light, after growing to the logarithmic growth phase, take 50mL of the algae liquid, centrifuge at 10,000r / min for 1min to collect the algae, freeze them in liquid nitrogen, grind them into powder, and extract the total RNA according to the method of Trizol;
[0028] 2) Primer design
[0029] According to the CrBbox gene published on the DOE JGI Chlamydomonas database as a template, the following specific primers were designed for PCR amplification:
[0030] CrBbox full-length amplification primer Primer sequence (5'→3')
[0031] Forward primer ATGTCGAGTTGCGTCGTGTGCG
[0032] Reverse Primer TTAGCACTCAGCGTCCAGGACCTCG
[0033] 3) Synthesis of cDNA
[0034] According to Takara's kit provided...
Embodiment 2
[0043] Example 2 The transformant obtained by overexpressing the CrBbox gene
[0044] 1) Construction of plant expression vectors
[0045]Primers with Bgl II and Spe I restriction sites were designed (forward: 5'-AAAGATCTAATGTCGAGTTGCGTCGTGTG-3'; reverse: 5'-AAACTAGTTTAGCACTCAGCGTCCAGGA-3'), and the full-length CrBbox gene was amplified by PCR. The CrBbox product modified by BglII and SpeI double digestion was ligated with the large fragment of the BGlII and SpeI double digestion vector of pCAMBIA1302. The ligation product was transformed into Escherichia coli DH5α, the positive clone was identified by PCR, and the plasmid was extracted for double enzyme digestion identification. The correct recombinant expression plasmid pCAMBIA1302-CrBbox was extracted for transformation.
[0046] 2) Acquisition of overexpressed CrBbox Chlamydomonas reinhardtii transformants (electrotransformation method)
[0047] Chlamydomonas reinhardtii (algae strain CC425, purchased from the Institute...
Embodiment 3
[0051] Example 3 Physiological Phenotype Observation of CrBbox Overexpression Algae Strain
[0052] 100 algae strains were selected from the pCMBIA1302 empty vector group, CrBbox overexpression group, and original algae strain CC425, and cultured in a light incubator at 24°C with 100 μmol m -2 sec -1 White light, under full light conditions, wait until the logarithmic growth phase, 2000rpm, centrifuge for 5min, resuspend in double distilled water, inoculate HSM-N liquid medium (2g / LNaAc 3H 2 O+1.44g / L K 2 HPO 4 +0.72g / L KH 2 PO 4 +0.5467g / L NaCl+20mg / LMgSO 4 ·7H 2 O+10mg / LCaCl 2 2H 2 O+1ml / L Trace-N), continuous shaking culture for 6 days. The following physiological values were measured every 24h.
[0053] 1) Biomass statistics
[0054] Biomass was calculated using a haemocytometer as described by Harris, 1989. The results showed that there was no significant difference in biomass between the strains overexpressing CrBbox gene and the non-transgenic strain CrCC4...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 