Unlock instant, AI-driven research and patent intelligence for your innovation.

Regulatory gene for synthesizing microalgae triacylglycerol as well as application thereof

A technology of microalgae triacylglycerol and gene regulation, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems of weak molecular mechanism research and scarce research reports

Inactive Publication Date: 2014-02-19
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with higher plants, the research on the molecular mechanism of TAG biosynthesis and accumulation in microalgae is still very weak, and the research reports on the functions of related genes in the TAG metabolic network are even rarer.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Regulatory gene for synthesizing microalgae triacylglycerol as well as application thereof
  • Regulatory gene for synthesizing microalgae triacylglycerol as well as application thereof
  • Regulatory gene for synthesizing microalgae triacylglycerol as well as application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] The cloning of embodiment 1CrBbox

[0026] 1) Total RNA extraction from Chlamydomonas reinhardtii

[0027] Chlamydomonas reinhardtii (Chlamydomonas reinhardtii) strain CC425, cultivated in a light incubator at 24°C, 100 μmolm -2 sec -1 Under the condition of white light and full light, after growing to the logarithmic growth phase, take 50mL of the algae liquid, centrifuge at 10000r / min for 1min to collect the algae, freeze them in liquid nitrogen, grind them into powder, and extract the total RNA according to the method of Trizol;

[0028] 2) Primer design

[0029] According to the CrBbox gene published on the DOE JGI Chlamydomonas database as a template, the following specific primers were designed for PCR amplification:

[0030] CrBbox full-length amplification primer Primer sequence (5'→3')

[0031] Forward primer ATGTCGAGTTGCGTCGTGTGCG

[0032] Reverse Primer TTAGCACTCAGCGTCCAGGACCTCG

[0033] 3) Synthesis of cDNA

[0034] According to Takara's kit provided ...

Embodiment 2

[0043] Example 2 The transformant obtained by overexpressing the CrBbox gene

[0044] 1) Construction of plant expression vectors

[0045]Primers with Bgl II and Spe I restriction sites were designed (forward: 5'-AAAGATCTAATGTCGAGTTGCGTCGTGTG-3'; reverse: 5'-AAACTAGTTTAGCACTCAGCGTCCAGGA-3'), and the full-length CrBbox gene was amplified by PCR. The CrBbox product modified by BglII and SpeI double digestion was ligated with the large fragment of the BGlII and SpeI double digestion vector of pCAMBIA1302. The ligation product was transformed into Escherichia coli DH5α, the positive clone was identified by PCR, and the plasmid was extracted for double enzyme digestion identification. The correct recombinant expression plasmid pCAMBIA1302-CrBbox was extracted for transformation.

[0046] 2) Acquisition of overexpressed CrBbox Chlamydomonas reinhardtii transformants (electrotransformation method)

[0047] Chlamydomonas reinhardtii (algae strain CC425, purchased from the Institute...

Embodiment 3

[0051] Example 3 Physiological Phenotype Observation of CrBbox Overexpression Algae Strain

[0052] 100 algae strains were selected from the pCMBIA1302 empty vector group, CrBbox overexpression group, and original algae strain CC425, and cultured in a light incubator at 24°C with 100 μmol m -2 sec -1 White light, under full light conditions, wait until the logarithmic growth phase, 2000rpm, centrifuge for 5min, resuspend in double distilled water, inoculate HSM-N liquid medium (2g / LNaAc 3H 2 O+1.44g / L K 2 HPO 4 +0.72g / L KH 2 PO 4 +0.5467g / L NaCl+20mg / LMgSO 4 ·7H 2 O+10mg / LCaCl 2 2H 2 O+1ml / L Trace-N), continuous shaking culture for 6 days. The following physiological values ​​were measured every 24h.

[0053] 1) Biomass statistics

[0054] Biomass was calculated using a haemocytometer as described by Harris, 1989. The results showed that there was no significant difference in biomass between the strains overexpressing CrBbox gene and the non-transgenic strain CrCC4...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a regulatory gene for synthesizing microalgae triacylglycerol as well as an encoded protein and an application thereof. The gene is originated from Chlamydomonas reinhardtii and has one of the following nucleotide sequences: 1) a DNA (deoxyribonucleic acid) sequence shown in SEQ ID NO:1 in a sequence table; 2) polynucleotide which encodes a protein sequence shown in SEQ ID NO:2 in the sequence table; 3) a DNA sequence which has over 90% homology with the DNA sequence limited by SEQ IN DO:1 in the sequence table and encodes the same functional protein as the DNA sequence limited by SEQ IN DO:1. The encoded protein of the gene is the protein with an amino acid residue sequence shown in SEQ ID NO:2 in the sequence table, ID of the protein is 159133 and the protein consists of 410 amino acid residues. The CrBbox gene can be applied to changing the content of neutral lipids in Chlamydomonas reinhardtii and can also be applied to cultivating novel algae strains with high lipid content.

Description

technical field [0001] The invention relates to a gene capable of significantly changing the neutral lipid content of microalgae, in particular to a regulatory gene capable of significantly changing the neutral lipid content of Chlamydomonas reinhardtii and its application. Background technique [0002] In the 21st century, with the rapid economic development, human consumption of fossil fuels such as petroleum is increasing day by day, and the use of fossil fuels has brought about serious environmental pollution problems. All countries in the world are looking for safe renewable energy. Bioenergy can indirectly or directly use the photosynthesis of plants or microorganisms to fix solar energy into chemical energy, which is the first choice for renewable energy. Biodiesel and fuel ethanol are currently bioenergy that can enter the market as gasoline additives. The composition of biodiesel is closer to gasoline, and it has a wide range of sources and low cost. It is one of th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/31C07K14/405C12N15/79C12R1/89
Inventor 邓晓东费小雯
Owner INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI