Unlock instant, AI-driven research and patent intelligence for your innovation.

Visual detection method of isothermal amplification products of nucleic acids

A technology of isothermal amplification and detection method, which is applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., and can solve problems such as endangering the health of operators, the influence of subjective factors of testers, and restrictions on popularization and application.

Inactive Publication Date: 2014-04-16
HARBIN DEGE BIOTECH
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The electrophoresis method requires the use of highly carcinogenic fluorescent dyes such as ethidium bromide, which not only endangers the health of the operator, but also causes cross-contamination; because the turbidity produced by the amplification reaction is not obvious, the turbidity method is easily affected by the subjective factors of the test personnel. The fluorescent dye method is mainly based on the detection of the amplified product DNA, while the LAMP reaction requires many pairs of primers, and the generation of primer dimers is inevitable, so the problem of false positives cannot be ruled out; the immunological lateral flow test paper requires After the amplification reaction, opening the cover and loading the sample for chromatography cannot overcome the problem of aerosol pollution; the market price of a real-time turbidimeter exceeds 400,000, which is much higher than the price of a PCR instrument, which limits the promotion of this technology in basic testing departments and medical departments application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Visual detection method of isothermal amplification products of nucleic acids
  • Visual detection method of isothermal amplification products of nucleic acids

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Amplification detection of specific gene IS6110 of human pathogenic Mycobacterium tuberculosis

[0028] Primer design

[0029] The 812-1045 nucleic acid sequence of the Shigella specific gene IS6110 was screened by consulting the literature and using BLAST software analysis, targeting at eight sites of this fragment (these eight sites are respectively: 812-831bp, 847-865 bp, 872–889 bp, 904–925 bp, 946–965 bp, 967–986, 996-1015 bp, and 1029–1045 bp) LAMP primers were designed and synthesized to obtain the following primers; primers were designed by LAMP-specific primer design The software is complete.

[0030] Forward outer primer F3—IS6110 AGACCTCACCTATGTGTCGA

[0031] Reverse outer primer B3—IS6110 TCGCTGAACCGGATCGA

[0032] Forward inner primer FIP-IS6110 ATGGAGGTGGCCATCGTGGAAGTTTTTCCTACGTGGCCTTTGTCAC

[0033] Reverse internal primer BIP—IS6110 AAGCCATCTGGACCCGCCAATTTTCCCCTATCCGTATGGTGGAT

[0034] Forward loop primer LF—IS6110 AGGATCCTGCGAGCGTAG

[0035] Revers...

Embodiment 2

[0043] Shigella specific genes in food iP amplification detection

[0044] Primer design

[0045] The nucleic acid sequence at position 232-437 of the Shigella specific gene ipaH was screened out by consulting the literature and using BLAST software analysis, targeting eight sites of the fragment (these eight sites were respectively: 233-254bp, 256-273 bp, 275-294 bp, 302-323bp, 341-362bp, 363-382bp, 386-405bp and 420-438bp) designed and synthesized LAMP primers to obtain the following primers; the primer design was completed by LAMP-specific primer design software.

[0046] Forward outer primer F3—ipaH CATGGCTGGAAAAACTCAGTGC

[0047] Reverse outer primer B3—ipaH GAGGCGGAACATTTCCCTG

[0048] Forward internal primer FIP—ipaH TCCTCACAGCTCTCAGTGGCATTTTTCTGCGGAGCTTCGACAG

[0049] Reverse inner primer BIP—ipaH ATCTCCGGAAAACCCTCCTGGTTTTTAGCGCCGGTATCATTATCGA

[0050] Forward loop primer LF—ipaH AGCAGCAACAGCGAAAGACT

[0051] Reverse loop primer LB—ipaH CCATCAGGCATCAGAAGGCC

[00...

Embodiment 3

[0059] Amplification and Detection of Macrobrachium rosenbergii Nodavirus RNA-2

[0060] Primer design

[0061] By reviewing the literature and analyzing with BLAST software, the Macrobrachium rosenbergii Nodavirus-specific gene fragment RNA-2 was screened out, targeting eight sites of the fragment (these eight sites were: 1976-1994bp, 1997-2007bp, 2007- 2032bp, 2057-2076bp, 2107-2136bp, 2171-2147bp, 2195-2178bp and 2198-2216bp) LAMP primers were designed and synthesized to obtain the following primers; the primer design was completed by LAMP-specific primer design software.

[0062] Forward outer primer F3—RNA-2 CCAATATGAACCGGGAGTG

[0063] Reverse outer primer B3—RNA-2 GGGTTCAACCTTGAGTTCC

[0064] Forward internal primer FIP—RNA-2 TCAGCCTAACTGCTGCGTATTTTTGGTTAAGAGTGGTAGTCCAA

[0065] Reverse inner primer BIP—RNA-2 TGGCTTAAGTTTCGGCGACGTTTTAC CAAGTTGTTCGACGAC

[0066] Forward loop primer LF—RNA-2 TGACAAGCAATATCAACTCAGATGG

[0067] Reverse loop primer LB—RNA-2 TGATCATCAGCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to two visual detection reagents of isothermal amplification products of nucleic acids, the two visual detection reagents are that 1-(1-hydroxy-2-naphthalene azo)-6-nitro-2-naphthol-4-sodium sulfonate or derivatives thereof (hereinafter referred to as the reagent 1) and 4-(2-pyridine azo) resorcinol sodium salt or derivatives thereof (hereinafter referred to as the reagent 2), the two visual detection reagents are used alone, at the beginning of a reaction, the reagent 1 combines with magnesium ions to become red, and the reagent 2 combines with the magnesium ions to form an orange complex, with the reaction, by-product pyrophosphate groups combines the magnesium ions to form a precipitation, the reagent 1 or loses the magnesium ions to become blue from red, the reagent 2 becomes yellow from orange, amplification reaction results can be judged by color change, detection without opening of a cover can be realized by the method, the aerosol pollution can be overcome, and the false positive problem caused by primer dimmers can be solved.

Description

technical field [0001] The invention relates to two types of nucleic acid isothermal amplification product visualization detection reagent 1-(1-hydroxy-2-naphthazo)-6-nitro-2-naphthol-4-sodium sulfonate or its derivatives (hereinafter referred to as reagents) 1) or 4-(2-pyridylazo)resorcinol sodium salt or its derivatives (hereinafter referred to as reagent 2). Background technique [0002] With the development of modern molecular biology and molecular technology, many nucleic acid amplification techniques have been researched and developed. Among them, the nucleic acid isothermal amplification technology, especially the nucleic acid loop-mediated isothermal amplification technology (loop-mediated isothermal amplification, LAMP), due to its strong specificity, high sensitivity, and fast reaction speed, has been used in nucleic acid-specific amplification and The detection field has a tendency to replace PCR and has become one of the hot spots in the field of life science re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6844C12Q2531/119C12Q2565/301
Inventor 王德国
Owner HARBIN DEGE BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More