Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of immunomodulatory polypeptide and its preparation method and application

An immune regulation and sequence technology, applied in the fields of medicine and bioengineering, can solve problems such as lack of research, and achieve the effect of reducing costs and promoting the proliferation of T lymphocytes.

Inactive Publication Date: 2019-03-29
NANJING MATERNITY & CHILD HEALTH CARE HOSPITAL
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no report on further research on these fragments and their functions in the prior art. Therefore, we screened some polypeptides for in-depth research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of immunomodulatory polypeptide and its preparation method and application
  • A kind of immunomodulatory polypeptide and its preparation method and application
  • A kind of immunomodulatory polypeptide and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] 1. The polypeptide has the following sequence characteristics:

[0048] Amino acid sequence:

[0049] SPTIPFFDPQIPKLTDLEN (SEQ ID NO: 1)

[0050] Nucleotide sequence:

[0051] TCTCCAACGATACCCCTTTTTTGACCCTCAAATCCCAAAAACTCACTGATCTTGAAAAT (SEQ ID NO: 2)

[0052] Has isoelectric point (pI): 4.03, molecular weight (Mw): 2172.46.

[0053] 2. After chemically synthesizing the polypeptide, it is found that the peptide has a strong effect of promoting the proliferation of human T lymphocytes (see figure 1 ).

[0054] use T lymphocyte separation reagent (ONE LAMBDA, US) was used to separate human blood T lymphocytes, and RPMI 1640 (containing 10% FCS, 100U / ml penicillin / streptomycin) culture medium was used to adjust the cell concentration to about 4×106 cells / ml.

[0055] (1) Collect the logarithmic phase cells, adjust the concentration of the cell suspension, add 100 μl to each well, plate to adjust the density of the cells to be tested to 1000-10000 wells, and fill the ed...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of medicine and bioengineering, and discloses immunoregulatory polypeptide as well as a preparation method and application thereof. The amino acid sequence of the immunoregulatory polypeptide is shown in SEQ ID NO:1. The immunoregulatory polypeptide is high in T lymphocyte proliferation promoting function, and can be used for preparing a drug capable of promoting T lymphocyte proliferation.

Description

technical field [0001] The invention belongs to the fields of medicine and bioengineering, and relates to an immunomodulatory polypeptide and its preparation method and application. Background technique [0002] Modern nutritional studies have found that most of the protein ingested by humans is digested and absorbed in the form of small peptides after the action of enzymes in the digestive tract, and the proportion absorbed in the form of free amino acids is very small. Further experiments have revealed that the absorption of small peptides is higher than that of free amino acids. Absorbs more quickly. Another new understanding of the nutritional role of peptides is that some bioactive peptides with special physiological regulation functions can be produced during the enzymatic hydrolysis of proteins. These bioactive peptides play an important role in regulating gastrointestinal motility, regulating the immune system, antihypertensive, antibacterial, antithrombotic, antivi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K7/08C12N15/11C12N15/70A61K38/10A61P35/00A23C9/152
Inventor 顾筱琪郭锡熔崔县伟季晨博杨蕾史春梅
Owner NANJING MATERNITY & CHILD HEALTH CARE HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com