Application of human GTPBP4 gene and related drugs of human GTPBP4 gene

A gene and drug technology, applied in the field of the use of human GTPBP4 gene and related drugs, can solve the problem of few reports on GTPBP4

Active Publication Date: 2016-05-18
SHANGHAI GENECHEM
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] There are few reports on

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of human GTPBP4 gene and related drugs of human GTPBP4 gene
  • Application of human GTPBP4 gene and related drugs of human GTPBP4 gene
  • Application of human GTPBP4 gene and related drugs of human GTPBP4 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] Example 1 Preparation of RNAi lentivirus against human GTPBP4 gene

[0079] 1. Screening for effective siRNA targets against the human GTPBP4 gene

[0080] Retrieve GTPBP4 (NM_012341) gene information from Genbank; design effective siRNA targets for GTPBP4 gene. Table 1 lists 5 effective siRNA target sequences for the GTPBP4 gene.

[0081] Table 1 is targeted at the siRNA target sequence of human GTPBP4 gene

[0082] SEQ ID NO

TargetSeq

1

GCGTAGTCTTGGTGTTGACAT

2

GCTGGAGAGTATGACAGTGTA

3

GCTCATCGAGTGGAAACCAAA

4

GCGTCAGCATTTATCCCGTTT

5

CCAACCGTTATTCATAAACAT

[0083] 2. Preparation of lentiviral vector

[0084] Aiming at the siRNA target (taking SEQIDNO: 1 as an example) synthetic double-stranded DNA Oligo sequence (table 2) containing AgeI and EcoRI restriction endonuclease at both ends; Acting on the pGCSIL-GFP vector ( Provided by Shanghai Jikai Gene Chemical Technology Co., Ltd., figure 1 ),...

Embodiment 2

[0105] Example 2 Real-time fluorescent quantitative RT-PCR method to detect the silencing efficiency of GTPBP4 gene

[0106] Colon cancer RKO cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, RKO: 10) value, an appropriate amount of the virus prepared in Example 1 was added, the culture medium was replaced after 24 hours of cultivation, and the cells were collected after the infection time reached 4 days. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV operation manual of Promega Company, the RNA was reverse-transcribed to obtain cDNA (reverse transcription reaction system is shown in Table 7, 42 ° C for 1 h) and then in a 70 ° C water bath for 10 min to inactivate the reverse transcriptase.

[0...

Embodiment 3

[0113] Example 3 Detection of proliferation ability of tumor cells infected with GTPBP4-siRNA lentivirus

[0114] Colon cancer RKO cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, RKO: 10), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 4 days, the cells of each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 2000 / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incubator cultivation. From the second day after plating, the CellomicsArrayScanVTI high-content screenin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses application of a human GTPBP4 gene and related drugs of the human GTPBP4 gene. The invention discloses application of the human GTPBP4 gene in tumor treatment, tumor diagnosis and drug preparation. The invention further constructs human GTPBP4 gene small interference RNA, a human GTPBP4 gene interference RNA constructor and a human GTPBP4 gene interference lentivirus and also discloses applications of the human GTPBP4 gene small interference RNA, the human GTPBP4 gene interference RNA constructor and the human GTPBP4 gene interference lentivirus. The siRNA or the RNA constructor or the lentivirus containing the sequence of the siRNA provided by the invention can specifically inhibit the expression of the human GTPBP4 gene, and especially, the lentivirus can effectively infect a target cell and effectively inhibit the expression of GTPBP4 gene in the target cell, so that the growth of tumor cells is inhibited and tumor cell apoptosis is promoted; therefore, the invention is of great significance in the treatment of tumors.

Description

technical field [0001] The invention relates to the field of biotechnology, and more specifically relates to the use of human GTPBP4 gene and related medicines. Background technique [0002] RNA interference (RNAi) is short double-stranded RNA (dsRNA) composed of nucleotides for post-transcriptional gene silencing. It can efficiently and specifically block the expression of a specific gene in the body, leading to its degradation, thereby causing the silencing of a specific gene in the organism, and causing the cells to show the absence of a certain gene phenotype. It is a commonly used research gene emerging in recent years. Functional, laboratory techniques for finding cures for disease. Studies have shown that double-stranded RNA with a length of 21-23nt can specifically cause RNAi at the transcriptional and post-transcriptional levels (TuschlT, ZamorePD, SharpPA, BartelDP. RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21to23nucleotide intervals....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/113C12N15/867C12N7/01A61K31/713A61P35/00
Inventor 朱向莹王小霞沈克吴涛金杨晟曹跃琼
Owner SHANGHAI GENECHEM
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap