Method for rapidly assembling non-phosphorylated DNA (deoxyribonucleic acid) fragments in vitro

A non-phosphorylated, fragmented technology, applied in the field of genetic engineering, can solve the problems of increasing the reaction rate, increasing the reaction time, and increasing steps, so as to achieve high-throughput operations and enrich the diversity of combinatorial mutations

Active Publication Date: 2016-09-21
JIANGNAN UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this technique not only requires pre-phosphorylation of each fragment, but also increases the experimental steps, and the three enzymes cannot simultaneously achieve a higher reaction rate in the Taq DNA ligase buffer system, thus prolonging the reaction time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapidly assembling non-phosphorylated DNA (deoxyribonucleic acid) fragments in vitro
  • Method for rapidly assembling non-phosphorylated DNA (deoxyribonucleic acid) fragments in vitro
  • Method for rapidly assembling non-phosphorylated DNA (deoxyribonucleic acid) fragments in vitro

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1 is optimized to the reaction system of assembly technology

[0033] Taking the green fluorescent protein gene gfp (sequence shown in SEQ ID NO: 1) and the pUC19 vector as examples, the assembly reaction buffer was optimized. First, the pH of the assembly reaction, Mg 2+ and NAD+, these three components were optimized, and a gfp amplification primer with a 30bp homology arm and a pair of vector pUC19 amplification primers were designed according to the gfp fragment and the vector sequence. Primers are as follows:

[0034] puc19-F: TTCTTCTCCCTTACCCATGGCGTAATCATGGTCATAGCTGTTTCCT

[0035] puc19-R: TGGATGAACTATACAAATAACTGGCCGTCGTTTTACAACGTCG

[0036] gfp-P30F:CATGATTACGCCATGGGTAAGGGAGAAGAA

[0037] gfp-P30R:CGACGGCCAGTTATTTGTATAGTTCATCCA

[0038] With primer puc19-F (sequence as shown in SEQ ID NO: 6) and puc19-R PCR (sequence as shown in SEQ ID NO: 7) amplified to prepare the vector fragment pUC19 for assembly reaction; using primer gfp-P30F (sequence As ...

Embodiment 2

[0041] Embodiment 2 uses the assembly technology of the present invention to quickly assemble 3 fragments

[0042] In order to verify the efficiency and accuracy of assembling multiple fragments, the green fluorescent protein gene gfp, the kanamycin gene kan (sequence shown in SEQ ID NO: 2) and the pUC19 vector were used as examples to assemble three fragments ( Figure 4 ). The primer information is as follows:

[0043] GK / pUC19-F:ATGAGTTCTTCTAAGTCATAGCTGTTTCCT

[0044] GK / pUC19-R:TGGATGAACTATACAAATAACTGGCCGTCGTTTTACAACGTCG

[0045] GK / gfp-F:CATGATTACGCCATGGGTAAGGGAGAAGAA

[0046] GK / gfp-R:TTGAATATGGCTCATTTATTTGTATAGTTCATCCA

[0047] GK / kan-F:AATAACTGGCCGTCGATGAGCCATATTCAACGGGAAAC

[0048] GK / kan-R:AGGAAACAGCTATGACTTAGAAGAACTCATCGAGCATC

[0049] Use primers GK / pUC19-F (sequence shown in SEQ ID NO: 10) and GK / pUC19-R (sequence shown in SEQ ID NO: 11) PCR amplification to prepare the vector fragment pUC19 for the assembly reaction; use primer GK / gfp-F (sequence shown in...

Embodiment 3

[0051] Example 3 Application of this assembly technology to quickly assemble 4 fragments

[0052] In order to verify the assembly ability of multiple fragments of this assembly method, the coenzyme A pathway gene derived from Escherichia coli was used to assemble four fragments. The three genes coaA (sequence shown in SEQ ID NO: 3), dfp (sequence shown in SEQ ID NO: 4), and coaD (sequence shown in SEQ ID NO: 5) of the pathway are expressed in tandem, and the expression vector for (eg Figure 5 shown), and designed and assembled into the vector pUC19 according to this sequence. The primer information of this embodiment is as follows:

[0053] COA / puc19-F: TGATGGCGAAGTTAGCGTAGGTCATAGCTGTTTCCT

[0054] COA / puc19-R: CTCTTTTATACTCATTACGAGCCGGAAGCATAAAG

[0055] COA / coaA-F:TGCTTCCGGCTCGTAATGAGTATAAAAAGAGCAAACGTTAAT

[0056] COA / coaA-R:ACCGGCCAGGCTCATTTATTTGCGTAGTCTGACCTCTTCT

[0057] COA / dfp-F:AGACTACGCAAATAAATGAGCCTGGCCGGTAAAAAAATCG

[0058]COA / dfp-R:CGCCCGTTTTTGCATTTAACGTCG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for rapidly assembling non-phosphorylated DNA (deoxyribonucleic acid) fragments in vitro, and belongs to the technical field of genetic engineering. Homologous arm sequences are introduced to the two terminals of a target fragment to be assembled and constructed, and the DNA fragment is rapidly assembled and constructed in vitro in a manner of thermal cycling for modification, annealing, cutting and connection. 2 to 4 non-phosphorylated DNA fragments can be efficiently, rapidly and seamlessly assembled at one time within 1.5h. The method can be used for conventional DNA recombination and construction and implementing high-throughput operation, and is particularly suitable for in-vitro efficient assembling of enzyme genes and synthetic pathways, and rich and diversified combinations and mutants can be introduced for rapid directional evolution and biological synthesis operation.

Description

technical field [0001] The invention relates to a method for quickly assembling non-phosphorylated DNA fragments in vitro, which belongs to the technical field of genetic engineering. Background technique [0002] The remarkable achievement in the field of molecular biology in the last century was the discovery of restriction endonuclease and DNA ligase, which established the basic technology for DNA recombination in vitro. Recombinant DNA technology has greatly promoted people's understanding of the structure and function of genes, and laid the foundation for the rapid development of enzyme engineering, metabolic engineering and synthetic biology. However, in the actual operation process, due to the limitation of restriction enzyme sites, the recombination construction of DNA fragments, especially the assembly construction of multiple fragments, the traditional conventional enzyme digestion and ligation technology appears to be stretched. The limited number of restriction ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10
CPCC12N15/1027C12Q2521/101C12Q2527/125C12Q2521/501
Inventor康振陈坚堵国成丁雯雯金鹏
OwnerJIANGNAN UNIV