Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleotide sequence for regulating and controlling synthesis of corn tocopherol and application of nucleotide sequence

A nucleotide sequence and tocopherol technology, applied in the biological field, can solve problems such as the difficulty in meeting the market demand and limited output of the annual output, and achieve the effects of improving the quality of corn oil products, increasing the expression level, and having a large application prospect

Active Publication Date: 2017-08-08
未米生物科技(海南)有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, the annual demand for natural vitamin E has increased by 10%, but the actual annual output is difficult to meet the market demand. The manufacturers are mainly concentrated in the United States, Japan, Germany and other developed countries, and China's domestic production is limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleotide sequence for regulating and controlling synthesis of corn tocopherol and application of nucleotide sequence
  • Nucleotide sequence for regulating and controlling synthesis of corn tocopherol and application of nucleotide sequence
  • Nucleotide sequence for regulating and controlling synthesis of corn tocopherol and application of nucleotide sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] The present invention utilizes the experimental platform of the ultra-high performance liquid chromatography in the applicant's laboratory, corn materials with wide diversity and adaptability, the constructed ultra-high-density linkage map, and abundant remaining hybrid materials to conduct tocopherol QTL The initial mapping and fine mapping of maize kernel to analyze the genetic basis of tocopherol.

[0046] The cloning method of the ZmPOR1 gene provided by the present invention is:

[0047] Using the D340×K22F6 population containing 192 materials, the tocopherol content of each material, including α, γ, and δ, was determined by ultra-high performance liquid chromatography, and combined with the high-density linkage map of the population, the QTL was performed with WinQTLcat V2.5 Mapping, chromosome 1 was mapped to a major QTL named qVTE1, which can explain 36% of the genetic variation of γ-tocopherol, and the two ends of the confidence interval are marked as PUT-163a-...

Embodiment 2

[0050] In order to verify the function of the ZmPOR1 gene, the applicant constructed an overexpression vector containing the gene:

[0051] The full-length sequence of ZmPOR1 gene was amplified in maize inbred line B73 with primer DMp455-F / R:

[0052] DMp455-F:

[0053] CTAGTATCCCGGGAA GGCGCGCC ATGGCGCTCCAGGCCGCGACGTCC, underlined as AcsⅠ

[0054] DMp455-R:

[0055] GAACGATAAGCTTAT GGCGCGCC TCACGCCAAGCCGACGAGCTTCTC, underlined as AcsⅠ

[0056] Based on a 20 μl reaction system, the amplified reaction system includes:

[0057]

[0058] The PCR amplification program is:

[0059]

[0060]

[0061] ⑤ Repeat ②③④ for 34 cycles;

[0062] ⑥72°C for 5 minutes.

[0063] It was connected to the overexpression vector pZZ-EGFP (provided by China Seed Group) through homologous recombination, the expression was driven by the ubiquitin promoter, and the constructed vector was transferred into an excellent maize inbred line C01. Since the vector contains the selection gene b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, in particular to a nucleotide sequence for regulating and controlling synthesis of corn tocopherol and application of the nucleotide sequence. A gene can be applied to specific research and regulation and control of expression of corn tocopherol, and the gene can also be transferred into a corn plant to perform overexpression, so that the content of tocopherol is increased, and the nucleotide sequence has a bright application prospect in the aspects of acquiring new corn species, improving the quality of the corn oil product, and the like.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a nucleotide sequence for regulating the synthesis of maize tocopherol and its application. Background technique [0002] Vitamin E (Vitamin E) is a fat-soluble antioxidant substance. The vitamin E series includes two groups: tocotrienol (T3) and tocopherol (T), both of which are composed of a polar aromatic ring head and The main difference is that the isoprenoid side chain of tocotrienol contains 3 unsaturated bonds while tocopherol has a saturated side chain. In nature, vitamin E has eight conformations. According to the position and number of methyl groups on the aromatic ring, tocopherol and tocotrienol can be divided into four types: α, β, γ, and δ. The antioxidant capacity of tocopherol and tocotrienol is determined by the ability to provide hydrogen atoms on the aromatic ring. In vivo, the order of antioxidant activity of the four tocopherols is α>β>γ>δ. It is estim...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415C12Q1/68A01H5/00
CPCC07K14/415C12N15/8243C12Q1/6895C12Q2600/13
Inventor 刘楠楠严建兵
Owner 未米生物科技(海南)有限公司