Multi-quenching fluorescent probe and method for detecting target nucleic acid sequence

A technology of target nucleic acid sequence and fluorescent probe, applied in the field of genetic engineering, can solve the problems of superposition of interference, high fluorescence background, affecting the interpretation of dissolution curve, etc., and achieve the effect of clear interpretation

CN108300772AActive Publication Date: 2018-07-20江西南兴医疗科技有限公司 +2
9 Cites 6 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Publication Date
2018-07-20

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention discloses a multi-quenching fluorescent probe and a method for detecting a target nucleic acid sequence. The multi-quenching fluorescent probe has two or more quenching groups. The method for detecting the target nucleic acid sequence comprises steps as follows: a to-be-detected nucleic acid sequence is taken as a template, a fluorescent PCR reaction is performed under the action ofa corresponding primer and the multi-quenching fluorescent probe, and a dissolution curve is drawn. Compared with other dissolution curve analysis technologies, the target nucleic acid sequence detection method based on cutting of hybrid sequence fluorescence quenching groups has the advantages that when no target sequence is detected, the fluorescent probe does not produce a fluorescent signal, so that the background is notably reduced during analysis of the dissolution curve, and detection of other positive target sequences cannot be affected; when multiple fluorescent probes are detected, the background signals of the fluorescent probes cannot interfere with each other, and accordingly, interpretation of multiple PCR is clearer.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention belongs to the technical field of genetic engineering. More specifically, the invention relates to a multiple quenching fluorescent probe and a detection method for target nucleic acid sequence detection based on hybridization sequence fluorescence quenching group cleavage and melting curve analysis. Background technique

[0002] Fluorescent PCR technology is a common technique for detecting target nucleic acid sequences. Currently, commonly used fluorescent PCR detection methods include Taqman probe method, molecular beacon probe method, hybridization probe method, etc. Among them, the Taqman probe method mainly relies on the exonuclease activity of nucleic acid polymerase. During the PCR extension process, the fluorescent probe hybridized with the target sequence is cut, and the 5' end fluorescent group is released. After the 5' end fluorescent group is released, The resulting rise in fluorescence detects the presence of the target sequ...

Examples

Embodiment 1

[0019] Example 1 Target nucleic acid sequence detection technology based on cleavage of fluorescent quencher group on hybridization sequence

[0020] see figure 1 , is a structural schematic diagram of a multiple quenched fluorescent probe for detecting target nucleic acid sequences of the present invention. The multiple quenched fluorescent probe includes two parts, and the 5' end is a fluorescent detection probe part, which includes a quenching group 1 and a fluorescent group This part is not combined with the target target sequence to be detected, and the 3' end is the target sequence binding part, which contains other quenching groups other than quencher group 1, and this part is reverse complementary to the target target sequence to be detected combined.

[0021] see figure 2 A-C, are schematic diagrams of the target nucleic acid sequence detection method based on the cleavage of the hybridization sequence fluorescence quencher group of the present invention. When the...

Embodiment 2

[0022] Example 2 Using the method of Example 1 of the present invention to detect different concentrations of target sequence templates

[0023] The method of Example 1 of the present invention was used to detect different concentrations of target sequence templates to evaluate its practicability. The target sequence template is an artificial plasmid (T vector plasmid, synthesized by Sangon Biotech (Shanghai) Co., Ltd.) containing the PCR amplification region, which is diluted to different concentrations of E2, E3, and E4 according to the concentration (10 2 copies / ul, 10 3 copies / ul, 10 4 copies / ul).

[0024] The instrument used is Shanghai Hongshi Slan-96p fluorescence quantitative PCR instrument.

[0025] The amplification primer sequences are:

[0026] NG-F:TACGCCTGCTACTTTCACGCT (SEQ ID No:1)

[0027] NG-R:CAATGGATCGGTATCACTCGC (SEQ ID No:2)

[0028] The fluorescent probe sequence is:

[0029] NG-P:ACGACGGCTTGGCTTTACTTCATGCCCCTCATTGGCGTGTTTCG

[0030] (SEQ ID No: 3...