Specific Marker and Method for Purity Identification of Balsam pear Changlv 2 Hybrid Seeds

A technology for the purity and specificity of hybrid seeds, applied in the field of specific markers for the purity identification of bitter gourd 'Changlu 2' hybrid seeds, which can solve the problems of susceptibility to cultivation measures and environmental factors, high input costs, and long time-consuming field cultivation identification, etc. problem, to achieve high commercial application value and low cost effect

Active Publication Date: 2019-06-25
INST OF VEGETABLES GUANGDONG PROV ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the identification of field cultivation takes a long time, is easily affected by cultivation measures and environmental factors, and the input cost is high. It does not meet the requirements of a large number of identifications in a short period of time.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific Marker and Method for Purity Identification of Balsam pear Changlv 2 Hybrid Seeds
  • Specific Marker and Method for Purity Identification of Balsam pear Changlv 2 Hybrid Seeds
  • Specific Marker and Method for Purity Identification of Balsam pear Changlv 2 Hybrid Seeds

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043]A kind of specific markers for the purity identification of bitter gourd 'Changlu 2' hybrid seeds, including specific markers P1-A (SEQ ID NO.1), P1-C (SEQ ID NO.2) in the female parent P091728 and the male parent Specific markers in S917007 P2-B (SEQ ID NO. 3), and P2-D (SEQ ID NO. 4).

[0044] SEQ ID NO.1:

[0045] TGAAACGGAACGAAACCTCCAGATCTCGAGAACTGGAGGAGGAGAGAGAAAGGAG AGAGAGAGAGAGAGAGAGAATTACCAGTGTTGGTGGGAACTGATCTCCAATTG CCAGGACCATGTTGTTGAATGTAAGAGGCAAGAAGGATGTCA;

[0046] SEQ ID NO.2:

[0047] TTTTCGTCTTCCAATGAGCCCTCGCTTCTTCTCTCTCTCTCTCTCTCTCTCACAA ATATCCAACGGCGCAGAAATATCCACCCCCGGTAAATCGCCTCCAACGGCGGATGAGGGATCCACGTTGATAATGTCGCTCCAACAGAATATCTGGATCAATTAGAACACGATCT GCTAAAGTCACAGGGCGTTCAA;

[0048] SEQ ID NO.3:

[0049] TGAAACGGAACGAAACCTCAGATCTCGAGAACTGGAGGAGGAGAGAGAAAGGAG AGAGAGAGAGAGAGAGAGAGAGAATTACCAGTGTTGGTGGGAACTGATCTCCAATTGCCAGGACCATGTTGTTGAATGTAAGAGGCAAGAAGGATGTCA;

[0050] SEQ ID NO.4:

[0051] TTTTCGTCTCCAATGAGCCCTCGCTTCTTCTCTCTCTCTCTCTCTCTCTCTCTCTCACAAAT...

Embodiment 2

[0053] A molecular marker primer for the purity identification of bitter melon 'Changlu 2' hybrid seeds, including SSR191192 and SSR203204, SSR191192 is used to amplify P1-A and P2-B, and SSR203204 is used to amplify P1-C and P2-D.

[0054] The nucleotide sequence of SSR191192 is:

[0055] SSR191192-F: 5'-TGACATCCTTCTTGCCTCTTACA-3' (SEQ ID NO.5),

[0056] SSR191192-R: 5'-TGAAACGGAACGAAACCTCA-3' (SEQ ID NO. 6).

[0057] The nucleotide sequence of SSR203204 is:

[0058] SSR203204-F: 5'-TTGAACGCCCTGTGACTTTAGC-3' (SEQ ID NO.7),

[0059] SSR203204-R: 5'-TTTTCGTCTTTCCAATGAGCC-3' (SEQ ID NO. 8).

Embodiment 3

[0061] A kind of balsam pear 'Changlv No. 2' hybrid seed purity identification method, use the specific marker in embodiment 1 and the molecular marker primer in embodiment 2, concrete steps are as follows:

[0062] (1) Extraction of Balsam pear DNA

[0063] Proceed as follows:

[0064] ①Take about 1 cm of tender leaves of bitter gourd to be tested 2 , put it in a 1.5mL centrifuge tube, add steel balls to cover it, immerse it in liquid nitrogen and freeze-dry it, and crush it in batches with a machine;

[0065] ② Add 600 μL 2×CTAB extraction buffer [20mmol / L EDTA (pH 8.0), 1.4mmol / L NaCl, 100mmol / L Tris-HCl (pH 8.0), 2%CTAB, 1%PVP] into the centrifuge tube, fully Mix well; place in a water bath at 65°C for 60 minutes, invert several times every 20 minutes, and shake well;

[0066] ③ Add an equal volume of chloroform, shake well, and centrifuge at 12000rpm for 10min at room temperature;

[0067] ④ After centrifugation, carefully pipette the supernatant solution into another...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
Login to view more

Abstract

The invention discloses a specific marker, marking primer and method to identify purity of hybrid seeds of Momordica charantia Chang Lv No. 2. The specific marker, the molecular marking primer and themethod can be used to distinguish the seeds of Momordica charantia Chang Lv No. 2 from other female and male parent seeds, allowing hybrid seed purity to be quickly detected; the specific marker, themolecular marking primer and the method have the advantages of high speed, good accuracy, low cost, high throughput, good convenience and practicality and the like; the method can replace a traditional method of identifying purity of hybrid seeds; the specific marker, the molecular marking primer and the method have high commercial application value.

Description

technical field [0001] The invention relates to the field of molecular detection, in particular to a specific mark and method for purity identification of hybrid seeds of bitter melon 'Changlu 2'. Background technique [0002] Bitter gourd is a monoecious and different-flowered crop. During the seed production process of bitter gourd hybrids, if the female parent is not detasselled in time or completely, the pollen of the female parent may fall on the female stigma of the female parent to produce self-seeds. False hybrids, this phenomenon happens from time to time. In addition, post-harvest mechanical mixing can also lead to variety mixing. Therefore, seed purity is one of the main indicators of hybrid seed quality inspection, and it is essential to identify the seed purity of bitter melon varieties after seed production or before sales, otherwise it may cause inestimable economic losses to seed operators and growers. loss. [0003] At present, the methods for identificat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895
Inventor 姚春鹏张长远张晓爱吴廷全金庆敏李海达王瑞娟
Owner INST OF VEGETABLES GUANGDONG PROV ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap