Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

GST gene cluster of upland cotton and application thereof in improving verticillium wilt resistance of plants

A technology of gene clusters and upland cotton, applied in the field of upland cotton GST gene clusters and its application in improving plant resistance to Verticillium wilt, can solve problems such as single breeding method, narrow genetic basis of upland cotton, and slow breeding progress

Pending Publication Date: 2018-09-04
HEBEI AGRICULTURAL UNIV.
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Conventional breeding methods have played an important role in the cultivation of cotton disease-resistant varieties, but due to the single breeding method, the narrow genetic basis of upland cotton, and the difficulty of distant hybridization between cotton species, the progress of breeding has been slow and cannot meet production needs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GST gene cluster of upland cotton and application thereof in improving verticillium wilt resistance of plants
  • GST gene cluster of upland cotton and application thereof in improving verticillium wilt resistance of plants
  • GST gene cluster of upland cotton and application thereof in improving verticillium wilt resistance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Functional Analysis of Upland Cotton GST Gene Cluster

[0032]The GST gene family analysis of the upland cotton genome found for the first time that two homologous tau clusters (including Gh_A09G1508, Gh_A09G1509 and Gh_A09G1510; Gh_D09G1520 and Gh_D09G1521) were undergoing genetic innovation and gene rebalancing in the genome after the formation of upland cotton. A homologous cluster was located on chromosome 9 of subgroups A and D of upland cotton. Through transcriptome, VIGS (virus-induced gene silencing) and overexpression experiments, it was proved that the cluster in subgroup A played an important role in the cotton Verticillium wilt resistance response, while the homologous cluster in subgroup D was degenerating ( One of the genes has been lost when passed from Raymond to upland cotton, one half is lost, and one is not expressed). This result strongly proves that the cluster located in subgroup A may have experienced higher selection pressure, and this...

Embodiment 2

[0035] Example 2 Acquisition of Cotton Verticillium Wilt Resistance Genes GhAt09g1508, GhAt09g1509 and GhAt09g1510

[0036] According to the sequencing results of Upland cotton TM-1 genome (Li et al., 2015; Zhang et al., 2015), the following primers were designed:

[0037] GhAt09g1508:F:TTGATATCATGGGCGAAGAAGTGCAGGTTTTTTGGC and R:TTGGATCCTCATTGGGAAAGACTAGCTTTGAC GCGhAt09g1509:F:GCTGAGCTCTTAGGCCTTAGCATTATCTT and R:AGAGGATCCATGGGTGAAGAAGTGAAGGhAt09gCCGAT09g1510:F:CCGAATTCGAGGAGTCGAATGGGTGAAGRAGGT

[0038] The genes GhAt09g1508, GhAt09g1509 and GhAt09g1510 were respectively cloned from cotton variety Nongda 601.

[0039] The nucleotide sequences of the genes GhAt09g1508, GhAt09g1509 and GhAt09g1510 are respectively shown in SEQ ID NO: 1-3.

Embodiment 3

[0040] Example 3 Functional analysis of genes GhAt09g1508, GhAt09g1509 and GhAt09g1510

[0041] 1. Functional analysis of the core gene Gh_A09G1509 of the upland cotton GST gene cluster

[0042] 1.1.qRT-PCR analysis showed that under the induction of Verticillium dahliae, the expression of Gh_A09G1509 in the roots of the resistant variety Nongda 601 was higher than that of the susceptible variety CCRI8, and the expression level was the highest at 12 hours after inoculation (Verticillium dahliae) ( figure 2 ), indicating that the gene is involved in the interaction between cotton and Verticillium dahliae.

[0043] 1.1.1 Planting and cultivation of sterile cotton seedlings

[0044] The seeds of Nongda 601 and CCRI8 were develored with concentrated sulfuric acid, rinsed with clean water and dried. Soak in clean water for 12 hours, change the water 2-3 times during the period, soak the white seeds with 0.1% mercuric chloride in an ultra-clean workbench for 1 minute, then steril...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a GST gene cluster of upland cotton and application thereof in improving verticillium wilt resistance of plants. The invention discloses the GST gene cluster of upland cotton for the first time, which includes cotton verticillium wilt resistance genes GhAt09g1508, GhAt09g1509 and GhAt09g1510, and reveals the biological function of the GST gene cluster, and plants containingthe gene cluster or the resistance genes show verticillium wilt resistance.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to the upland cotton GST gene cluster and its application in improving plant Verticillium wilt resistance. Background technique [0002] Cotton Verticillium wilt (Verticillium wilt) is a soil-borne vascular disease, and its pathogenic bacteria are mainly Verticillium dahliae and Verticillium albo-atrum, which were introduced from the United States in 1935. The 4B variety of cotton was introduced into my country. Verticillium wilt has now spread to the three major cotton regions in my country, seriously threatening the safety of my country's cotton industry. In 2009, more than 50% of the cotton fields in my country suffered from Verticillium wilt to varying degrees. The survey found that Verticillium dahliae is the main pathogenic bacteria of cotton verticillium wilt in the major cotton regions of my country. Once Verticillium wilt of cotton occurs, the diseased a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29A01H5/00A01H6/82A01H6/60
CPCC07K14/415C12N15/8282
Inventor 李志坤马峙英王省芬张桂寅吴立强陈斌
Owner HEBEI AGRICULTURAL UNIV.
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com