Application of crRNA mediated CRISPR/Cas13a gene editing system in tumor cells

A tumor cell and gene editing technology, applied in the field of DNA recombination, can solve the problem of less application of CRISPR/Cas13a system, and achieve the effect of reducing tumor cell index, inhibiting tumor formation rate and tumor size

Active Publication Date: 2018-09-18
GENERAL HOSPITAL OF TIANJIN MEDICAL UNIV
View PDF2 Cites 36 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In order to solve the problem that the CRISPR / Cas13a system is rarely used in eukaryotic and tumor cells, the present invention proposes the application of a crRNA-mediated CRISPR / Cas13a gene editing system in tumor cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of crRNA mediated CRISPR/Cas13a gene editing system in tumor cells
  • Application of crRNA mediated CRISPR/Cas13a gene editing system in tumor cells
  • Application of crRNA mediated CRISPR/Cas13a gene editing system in tumor cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0024]Cas13a基因序列为:ATGAAAGTGACCAAGGTCGACGGCATCAGCCACAAGAAGTACATCGAAGAGGGCAAGCTCGTGAAGTCCACCAGCGAGGAAAACCGGACCAGCGAGAGACTGAGCGAGCTGCTGAGCATCCGGCTGGACATCTACATCAAGAACCCCGACAACGCCTCCGAGGAAGAGAACCGGATCAGAAGAGAGAACCTGAAGAAGTTCTTTAGCAACAAGGTGCTGCACCTGAAGGACAGCGTGCTGTATCTGAAGAACCGGAAAGAAAAGAACGCCGTGCAGGACAAGAACTATAGCGAAGAGGACATCAGCGAGTACGACCTGAAAAACAAGAACAGCTTCTCCGTGCTGAAGAAGATCCTGCTGAACGAGGACGTGAACTCTGAGGAACTGGAAATCTTTCGGAAGGACGTGGAAGCCAAGCTGAACAAGATCAACAGCCTGAAGTACAGCTTCGAAGAGAACAAGGCCAACTACCAGAAGATCAACGAGAACAACGTGGAAAAAGTGGGCGGCAAGAGCAAGCGGAACATCATCTACGACTACTACAGAGAGAGCGCCAAGCGCAACGACTACATCAACAACGTGCAGGAAGCCTTCGACAAGCTGTATAAGAAAGAGGATATCGAGAAACTGTTTTTCCTGATCGAGAACAGCAAGAAGCACGAGAAGTACAAGATCCGCGAGTACTATCACAAGATCATCGGCCGGAAGAACGACAAAGAGAACTTCGCCAAGATTATCTACGAAGAGATCCAGAACGTGAACAACATCAAAGAGCTGATTGAGAAGATCCCCGACATGTCTGAGCTGAAGAAAAGCCAGGTGTTCTACAAGTACTACCTGGACAAAGAGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses application of a crRNA mediated CRISPR/Cas13a gene editing system in tumor cells. According to the invention, in a U87 glioma cell system, a Cas13a protein can be mediated ontocomplementary target RNA by single-stranded crRNA and is cut. Meanwhile, the Cas13a protein can also trigger a joint shearing effect in eucaryotic cells, i.e., after starting to cut a first piece oftarget RNA, the Cas13a protein carries out aimless random cutting on other encountered RNA so as to take effects of inhibiting and killing tumors, such as effects of reducing a tumor cell index, inhibiting a mouse tumor formation rate and a tumor size. The invention provides a novel method for inhibiting or killing the tumor cells so as to lay a foundation for application of a random shearing effect of the CRISPR-Cas13 system in eukaryotic cells.

Description

technical field [0001] The present invention relates to DNA recombination technology, more specifically the application of a crRNA-mediated CRISPR / Cas13a gene editing system in tumor cells. Background technique [0002] Short palindromic repeats (Clustered regularly interspaced shot palindromicrepeat, CRISPR) and CRISPR-associated proteins (Cas) are adaptive immune systems of archaea and bacteria. Cas proteins are mainly divided into two categories: adaptation module and effector module. The acquisition module can import exogenous nucleic acid information into the CRISPR sequence and generate CRISPR RNAs (crRNAs) as a guide for the system. Under the mediation of crRNA, the effector module cleaves the nucleic acid invaded by exogenous sources. In the CRISPR-Cas system, the acquired modules have a high degree of similarity, mainly including Cas1 and Cas2. In contrast, there are many types of effector systems, which are mainly divided into Class 1 systems (C1) and Class 2 sy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/90C12N15/113
CPCC12N15/113C12N15/907C12N2310/10C12N2310/20
Inventor 康春生王琦雪周俊虎
Owner GENERAL HOSPITAL OF TIANJIN MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap