Unlock instant, AI-driven research and patent intelligence for your innovation.

Strain and method for producing beta-phenethyl alcohol

A technology of phenylethyl alcohol and bacterial strains, applied in the biological field, can solve the problems of low concentration of β-phenylethyl alcohol products and less selection of production strains, and achieve the effects of easy control of fermentation conditions, good industrial application value, and low raw material cost

Active Publication Date: 2018-10-09
SHANGHAI INST OF TECH
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the above-mentioned technical problems in the prior art, the invention provides a kind of bacterial strain and method for producing β-phenylethanol, and the described bacterial strain and method for producing β-phenylethylalcohol will solve the problem of producing β-phenylethanol by biological method in the prior art. -Technical problems of low concentration of phenylethanol product and few types of production strains

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Strain and method for producing beta-phenethyl alcohol
  • Strain and method for producing beta-phenethyl alcohol
  • Strain and method for producing beta-phenethyl alcohol

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Screening of Enterobacter sp.strain MF024 Strain

[0038] Collect root soil samples of roses, roses, lilies, etc. in forest parks around Shanghai, weigh 0.5-1.5g and dissolve them in sterile water, add an appropriate amount of glass beads and mix well, then add them to the liquid bacterial screening medium. Under the condition of 28-37 ℃, 200-300rpm shaker shakes and cultivates for 48h, then transfers to fresh liquid bacterial selection medium with 5% inoculum size (V / V) and cultivates for 24-48h, repeats this process 3- 5 times. Dilute the cultured bacteria by 10 -7 Double-coated on the solid bacterial screening medium, and cultured in an incubator at 30°C for 24-72h.

[0039] The morphology of the bacteria was observed under a microscope, and single colonies of different shapes were selected to be streaked on the solid bacterial screening medium, and cultured in an incubator at 30°C for 24-48h. Repeat 3-6 times until the morphology of the bacteria observed under th...

Embodiment 2

[0045] Strain 16S rDNA identification:

[0046] Enterobacteriaceae (MF024) obtained in the present invention were sent to Shanghai Sangon Bioengineering Co., Ltd. for detection of 16S rDNA sequence. The obtained 16S rDNA sequence of the strain is shown in the sequence table SEQ ID NO:1.

[0047] Among them, the general primers for PCR of 16S rDNA are:

[0048] 27F (5'→3'):agagtttgatcctggctcag;

[0049] 1492R (5'→3'): ggttacccttgttacgactt.

[0050] The 16S rDNA sequence (GenBank No. MG554655) of the strain of the present invention (MF024) was homologously compared with the 16S rDNA sequence in GenBank, and it was found that the highest similarity with Enterobacter strains was 99%, but not completely identical.

Embodiment 3

[0052] Physiological and biochemical identification:

[0053] Pick a single colony (MF024) of the bacterial strain of the present invention, inoculate it in LB liquid medium with a pH of 7.0, cultivate it at 30° C. and 200 rpm for 24 hours, and insert it into the biochemical identification strip of Enterobacteriaceae of Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd. , to detect its physiological and biochemical properties. The results of the physiological and biochemical characteristics of the strain are as follows:

[0054] Table 1: Results of physiological and biochemical characteristics of Enterobacter sp.strain MF024

[0055]

[0056]

[0057] Symbols: +, 90%-100% of the strains are positive; -, 90%-100% of the strains are negative; D40%-60% of the strains are positive.

[0058] Physiological and biochemical characteristics indicated that this strain conformed to the relevant properties of the genus Enterobacter.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a strain for producing beta-phenethyl alcohol. The classification name of the strain is Enterobacter sp., and the preservation number of the strain is CGMCC No. 15641. The invention further provides a method using the strain to produce beta-phenethyl alcohol. The method includes: activating the Enterobacter, performing liquid fermentation, and performing tank fermentation; performing concentration extraction on the beta-phenethyl alcohol. Detection shows that beta-phenethyl alcohol yield can reach up to 0.5g / L. The Enterobacter MF024 is good in genetic stability, low inculture cost and the like. The fermentation and extraction method is mild in reaction condition, low in cost, environmentally friendly and the like. The obtained beta-phenethyl alcohol is green and natural and has great industrial application advantages.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a newly isolated enterobacteriaceae and a method for producing beta-phenylethanol through biotransformation of L-phenylalanine. technical background [0002] β-phenylethanol, also known as 2-phenylethanol, the molecular formula is C 8 h 10 O, a colorless viscous liquid at normal temperature and pressure, naturally exists in the essential oils of some flowers and plants such as rose, hyacinth, jasmine, narcissus, yellow orchid, lily, etc. β-Phenylethyl alcohol is a kind of aromatic alcohol with rose flavor. It is not only widely used in food, medicine, cosmetics, tobacco and daily chemical products, but also its derivative esters such as phenylethyl acetate, propionic acid- 2-Phenylethyl ester and others are important aromatic products; now β-phenylethyl alcohol has developed into the second largest fragrance substance after vanillin. [0003] The production methods of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P7/22C12N1/20C12R1/01
CPCC12P7/22C12N1/205C12R2001/01
Inventor 荣绍丰伍进李茜茜管世敏蔡宝国张硕
Owner SHANGHAI INST OF TECH