Unlock instant, AI-driven research and patent intelligence for your innovation.

Pseudorabies virus gc protein antibody, kit containing the antibody and application

A pseudorabies virus and kit technology, applied in the field of animal husbandry biopharmaceuticals, can solve problems such as accurate investigation and prevention, troublesome treatment, no ability to detect virus-infected tissue or cell localization, etc., and achieve the effect of solving key problems

Active Publication Date: 2021-08-20
LUOYANG PULIKE WANTAI BIOTECH
View PDF13 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These antibodies are all research reagents, have not been tested or verified in a large number of clinical cases, and do not have the key ability to detect virus-infected tissues or cells, causing trouble for accurate epidemiological investigations and later prevention and treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pseudorabies virus gc protein antibody, kit containing the antibody and application
  • Pseudorabies virus gc protein antibody, kit containing the antibody and application
  • Pseudorabies virus gc protein antibody, kit containing the antibody and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0058] According to some embodiments of the present invention, the immunohistochemical method comprises the following steps:

[0059] Step 1) Obtaining materials: collecting tonsil, brain, lung and other tissue samples of pigs, quickly placing them in formalin for fixation, and appropriately trimming them if necessary;

[0060] Step 2) Preparation of paraffin sections: After the fixed tissue samples are rinsed with running water, they are dehydrated, transparent, and soaked in wax with an automatic dehydrator. After embedding with an embedding machine, they are sectioned, displayed, and mounted on treated glass slides. , baked slices;

[0061] Step 3) Inhibition of endogenous enzymes: dewax the slides to distilled water, add 3% H 2 o 2 Stand to inhibit endogenous enzymes;

[0062] Step 4) Antigen restoration: use antigen heat restoration such as high-pressure heat restoration, boiling heat restoration, microwave heat restoration, or enzyme digestion to treat the slides afte...

Embodiment 1

[0117] Embodiment 1: Preparation containing pseudorabies virus gC protein

[0118] 1.1 Preparation of PRVgC protein

[0119] Inoculate the PRV HN1201 virus or its cultures of different generations on well-growing PK15 cells (PRV HN1201 strain preservation number is CCTCC NO.V 201311, see patent CN104004774A), and the cultures of different generations are within 5-35 generations Culture, extraction of PRV genomic DNA, design of primers

[0120]gC1-F:CGCGGATCCATGGCCTCGCTCGCGCGTGCGAT

[0121] gC1-R:TGTGAAGCTTTCACAGCGCGGACCGGCGGTAGT

[0122] And according to the patent CN104004774A method to prepare PRVgC protein, BCA protein concentration determination kit (purchased from Shanghai Biyuntian Biotechnology Co., Ltd.) instructions in the determination of PRVgC protein (referred to as PRVgC1), the content is 160 μ g / ml.

[0123] 1.2 Preparation of tandem expression protein containing PRVgC protein

[0124] design primers

[0125] gC2-F:CCAATGCATATGGCCTCGCTCGCGCGTGCGA

[0126] g...

Embodiment 2

[0155] Example 2: Preparation, purification and identification of pseudorabies virus gC protein monoclonal antibody

[0156] 2.1 Preparation and purification of PRVgC protein monoclonal antibody

[0157] First, the PRV HN1201 strain virus fluid (2×10 8 TCID 50 / ml) were inactivated by formaldehyde, β-propiolactone, and divinylimine BEI respectively, and 10 mice / group were immunized after grouping and emulsified with Freund's adjuvant, and the ELISA method coated with PRVgC1 prepared in Example 1 Continuous ELISA testing was carried out on the serum of mice after 3-7 times of immunization. The results: the ELISA titers of the serum of mice in each group were all ≤1:400, and one mouse was selected for cell fusion. The positive rate after fusion was 0, so it was discarded.

[0158] Next, 10 mice were immunized with PRVgC1 prepared in Example 1 and Freund's adjuvant in an equal volume after emulsification, and immunized once every 2 weeks. The serum ELISA was continuously teste...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the variable region sequence of the mouse monoclonal antibody specifically binding to pseudorabies virus gC protein, which is the variable region sequence of mouse monoclonal antibody 1B9 or the variable region sequence of mouse monoclonal antibody 1F2; the present invention also relates to Composed of heavy chain variable region sequences or conservative variants thereof in said variable region sequences, and / or corresponding light chain variable region sequences or conservative variants thereof in said variable region sequences Antibody to pseudorabies virus gC protein. The immunohistochemical method established with the antibody solves the problems that PCR cannot perform clear localization in tissues and cells, track the dynamic distribution of pathogens in the body, and perform qualitative and semi-quantitative detection. The kit containing the antibody accurately detects the content of PRVgC protein based on the sandwich principle of double monoclonal antibodies, and overcomes the technical problems that the PRVgC protein cannot be accurately quantified after tandem expression or fusion expression with other proteins, and the expected expression effect cannot be verified.

Description

technical field [0001] The invention belongs to the technical field of animal husbandry biopharmaceuticals, and relates to a pseudorabies virus gC protein antibody, a kit containing the antibody and an application. Background technique [0002] Porcine pseudorabies, also known as Aujeszky's disease, is caused by porcine herpesvirus type I (Suid herpesvirus type I, also known as pseudorabies virus Pseudorabies virus, PRV) in the herpesviridae (Herpesviridae) α subfamily. , sheep, dogs, cats, rabbits, rats, wild boars, mink, bears, foxes and other domestic and wild animals are an acute infectious disease characterized by fever, itching (except pigs) and encephalomyelitis. [0003] Pseudorabies in pigs is widespread in our country, and it is seriously harmful. It is one of the main diseases restricting the production of large-scale pig farms. It can cause abortion, stillbirth or mummified fetuses in pregnant sows, and neurological symptoms, paralysis, and respiratory symptoms i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/569G01N33/577
CPCG01N33/56983G01N33/577
Inventor 田克恭王莹
Owner LUOYANG PULIKE WANTAI BIOTECH