Pseudorabies virus gC protein antibody, kit containing antibody and application
A pseudorabies virus and antibody technology, applied in the field of animal husbandry biopharmaceuticals, can solve problems such as accurate investigation and prevention, troublesome treatment, no ability to detect virus-infected tissues or cells, and achieve the effect of solving key problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach
[0058] According to some embodiments of the present invention, the immunohistochemical method comprises the following steps:
[0059] Step 1) Obtaining materials: collecting tonsil, brain, lung and other tissue samples of pigs, quickly placing them in formalin for fixation, and appropriately trimming them if necessary;
[0060] Step 2) Preparation of paraffin sections: After the fixed tissue samples are rinsed with running water, they are dehydrated, transparent, and soaked in wax with an automatic dehydrator. After embedding with an embedding machine, they are sectioned, displayed, and mounted on treated glass slides. , baked slices;
[0061] Step 3) Inhibition of endogenous enzymes: dewax the slides to distilled water, add 3% H 2 o 2 Stand to inhibit endogenous enzymes;
[0062] Step 4) Antigen restoration: use antigen heat restoration such as high-pressure heat restoration, boiling heat restoration, microwave heat restoration, or enzyme digestion to treat the slides afte...
Embodiment 1
[0117] Embodiment 1: Preparation containing pseudorabies virus gC protein
[0118] 1.1 Preparation of PRVgC protein
[0119] Inoculate the PRV HN1201 virus or its cultures of different generations on well-growing PK15 cells (PRV HN1201 strain preservation number is CCTCC NO.V 201311, see patent CN104004774A), and the cultures of different generations are within 5-35 generations Culture, extraction of PRV genomic DNA, design of primers
[0120]gC1-F:CGCGGATCCATGGCCTCGCTCGCGCGTGCGAT
[0121] gC1-R:TGTGAAGCTTTCACAGCGCGGACCGGCGGTAGT
[0122] And according to the patent CN104004774A method to prepare PRVgC protein, BCA protein concentration determination kit (purchased from Shanghai Biyuntian Biotechnology Co., Ltd.) instructions in the determination of PRVgC protein (referred to as PRVgC1), the content is 160 μ g / ml.
[0123] 1.2 Preparation of tandem expression protein containing PRVgC protein
[0124] design primers
[0125] gC2-F:CCAATGCATATGGCCTCGCTCGCGCGTGCGA
[0126] g...
Embodiment 2
[0155] Example 2: Preparation, purification and identification of pseudorabies virus gC protein monoclonal antibody
[0156] 2.1 Preparation and purification of PRVgC protein monoclonal antibody
[0157] First, the PRV HN1201 strain virus fluid (2×10 8 TCID 50 / ml) were inactivated by formaldehyde, β-propiolactone, and divinylimine BEI respectively, and 10 mice / group were immunized after grouping and emulsified with Freund's adjuvant, and the ELISA method coated with PRVgC1 prepared in Example 1 Continuous ELISA testing was carried out on the serum of mice after 3-7 times of immunization. The results: the ELISA titers of the serum of mice in each group were all ≤1:400, and one mouse was selected for cell fusion. The positive rate after fusion was 0, so it was discarded.
[0158] Next, 10 mice were immunized with PRVgC1 prepared in Example 1 and Freund's adjuvant in an equal volume after emulsification, and immunized once every 2 weeks. The serum ELISA was continuously teste...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


