Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Biomarker for pre-employment screening of workers exposed to noise

A gene marker and noise technology, applied in the field of biotechnology, can solve the problems of body hearing loss, noise-induced deafness, etc., and achieve the effect of high sensitivity and simple operation

Active Publication Date: 2019-08-06
SOUTHEAST UNIV
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Long-term exposure to harmful noise environments without taking corresponding effective protective measures may cause irreversible and permanent hearing loss to the body, and eventually lead to severe noise-induced deafness

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biomarker for pre-employment screening of workers exposed to noise
  • Biomarker for pre-employment screening of workers exposed to noise
  • Biomarker for pre-employment screening of workers exposed to noise

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0029] The present invention will be further explained below in conjunction with the accompanying drawings and specific embodiments.

[0030] Selection of research subjects

[0031] In this study, 1140 noise-exposed workers from 3 large machinery factories were selected, and demographic data and on-site noise exposure data were collected. According to the "Diagnostic Criteria for Occupational Noise Deafness" (GBZ49-2007), the hearing examination was carried out for the research objects. The workers whose binaural average high-frequency hearing threshold ≥ 25dB was selected as the hearing loss group, and the workers whose hearing loss was less than 25dB were selected as the control group, and the research objects were all Han nationality. The inclusion criteria for all research objects are: (1) Workers who have been exposed to steady-state noise environments for more than three years; (2) Workers who have not been exposed to chemical harmful factors such as heavy metals, organi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a blood corpuscle gene marker detection method for workers exposed to noise. The biomarker is the rs77684420 locus and rs6726395 locus of a NFE2L2 gene; the rs77684420 locus ofthe NFE2L2 gene is shown as SEQ ID NO : 1-2 which is TGAAGGTTACCAATATATTAAATGC[C / T]GTGGAATCAACGATTTTTATGTTC; and the rs6726395 locus is shown as SEQ ID NO : 3-4 which is TTTAATTATTCCATCCTACCCAAGC[A / G]TACAGATGTTAGTGGATCAAATGAG. The method firstly extracts DNA from the blood corpuscle of workers in a control group matching the ages and genders of the works in a noise hearing loss group, four gene loci can be detected, and the correlation of rs77684420 locus at 5'UTR area of the NFE2L2 gene, rs6726395 locus in an intron area and haplotype GAGT polymorphism and noise hearing loss can be verified;and the gene marker taken as pre-employment screening of the workers exposed to noise is simple in operation, high in sensitivity and suitable for large scale screening of susceptible population, andtherefore, bases can be provided for the pre-employment screening of the workers exposed to noise.

Description

technical field [0001] The invention relates to a biomarker used for pre-employment screening of noise-exposed workers and an application thereof, belonging to the field of biotechnology. Background technique [0002] Noise-induced hearing loss (NIHL, Noise-induced Hearing Loss) is a complex multifactorial disease formed by the interaction of environmental factors and genetic factors. With the continuous acceleration of the industrialization process, more and more noise hazards appear in people's daily life, and noise-induced hearing loss has become one of the main deafness-causing factors. Its incidence is also high in developed industrialized countries. There are about 22 million workers in the United States who are exposed to harmful noise environments every day. More than 10 million Chinese workers are exposed to excessive noise environments, and about 10% of them suffer from noise-induced hearing loss to varying degrees. Currently, noise-induced hearing loss is the se...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883
CPCC12Q1/6883C12Q2600/156
Inventor 王博深张娟朱宝立浦跃朴尹立红王宁
Owner SOUTHEAST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com