Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

157 results about "Blood corpuscle" patented technology

Blood corpuscle. Etymology: AS, blod + L, corpusculum, little body. an old term for a blood cell, an erythrocyte, a leukocyte, and sometimes a thrombocyte. A virtually extinct term for any cell which is normally present in the peripheral circulation such as the, red corpuscle (red blood cell) and white corpuscle (white blood cell or leukocyte).

System and method for in vitro blood vessel modeling

ActiveUS20110053207A1Reduce non-physiological shear stressMicrobiological testing/measurementLaboratory glasswaresCell layerVascular pathology
The present invention provides an in vitro blood vessel model for investigation of drug induced vascular injury and other vascular pathologies. The in vitro blood vessel model provides two channels separated by a porous membrane that is coated on one side by an endothelial cell layer and is coated on the other side by a smooth muscle cell layer, wherein said model is susceptible to the extravasation of red blood cells across said porous membrane due to drug induced vascular injury.
Owner:CHARLES STARK DRAPER LABORATORY +1

Blood DNA conserving card and method for making the same

The invention relates to 'a blood DNA preserving card and production method' and belongs to the biology technical field. A blood DNA preserving card comprises fiber-shaped media with the ability of absorbing DNA, and is characterized in that: the salinity is absorbed in the media and contains cell lysing reagent, nuclease inhibitor, a substance allowing the pathogenic bacterium and the virus protein to be denaturalized as well as anti-oxidization inhibitor. These salinities can inhibit the activities of the viruses to prevent the infection, can prevent the nuclease from gradating DNA, so that the blood DNA can be preserved indoor for a long-term. The pure DNA can be obtained from the preserved DNA in the card of the invention by bleaching the salt ions and blood corpuscle leftovers on the card media with the water, thereby avoiding the extraction process, ensuring the operation is simpler, being convenient to be operated in batches and saving the expense of the DNA extraction agent.
Owner:DINGSHENG TECH BEIJING +1

Blood storage bag system and depletion devices with oxygen and carbon dioxide depletion capabilities

A blood storage system. The system has a collection bag for red blood cells; an oxygen / carbon dioxide depletion device; a storage bag for red blood cells; and tubing connecting the collection bag to the depletion device and the depletion device to the storage bag. The depletion device includes a receptacle of a solid material having an inlet and an outlet adapted to receiving and expelling a flushing gas; a plurality of hollow fibers or gas-permeable films extending within the receptacle from an entrance to an exit thereof. The hollow fibers or gas-permeable films are adapted to receiving and conveying red blood cells.
Owner:NEW HEALTH SCI

Multilevel sorting microfluidic device for rare cells

The invention provides a multilevel sorting microfluidic device for rare cells. The multilevel sorting microfluidic device comprises a runner structure sealed through bonding and an electrode substrate, wherein the runner structure comprises a spiral runner, a second grade runner, a lower branch runner, an upper bifurcated runner and a lower bifurcated runner, one end of the spiral runner is a sample inlet, the other end of the spiral runner is connected with the second grade runner and the lower branch runner respectively through a shrink and expansion structure, the second grade runner is connected with the upper bifurcated runner and the lower bifurcated runner respectively, the upper bifurcated runner and the lower branch runner are connected with the outlet of a blood corpuscle, the lower bifurcated runner is connected with the outlet of the rare cell, the electrode substrate comprises a substrate body and two groups of electrode groups, and the electrode groups are arranged at the bottom of the second grade runner. The multilevel sorting microfluidic device for the rare cells has low cost, is simple to operate, is easily integrated into micromation, and can realize high flux and high purity sorting of rare cancer cells.
Owner:SOUTHEAST UNIV

Technology using swine fresh pancreatin to produce swine blood protein peptide and haemoglobin

The invention relates to a method using pancreatin-hydrolyzed swine blood corpuscle protein activated by swine fresh pancreas to produce swine blood protein peptide and haemoglobin, belonging to the field of feed additive. The invention takes fresh healthy swine blood corpuscle liquid as a raw material, pancreatin activated by swine fresh pancreas is hydrolyzed and filtered, the filtered supernatant is decolorized, then, the obtained protein liquid is dried to obtain the golden swine blood protein peptide, and the filter cake is dried to obtain the haemoglobin. The technical method has the following innovation points: 1, swine pancreas is taken as the raw material which is fresh and available, and the quality is controllable; 2, pancreatin activation method is simple, enzyme systems are rich, the activated enzyme has high activity, and the hydrolysis effect is good; 3, the swine fresh pancreatin has low cost, which is easy to carry out expanded production; 4, the swine blood corpuscle protein is hydrolyzed by pancreatin which can efficiently separate the haemoglobin thereof and can further prepare haemoglobin by drying the filter cake as the hydrolysate product, thus greatly improving the rate of multipurpose utilization of the swine blood corpuscle protein and avoiding resource waste.
Owner:天津宝迪农业科技股份有限公司

Method for comprehensively using pig blood

The invention belongs to the technical field of separation and extraction of bioactive substance and particularly relates to a method for preparing thrombin and pig blood protein hydrolysate respectively by taking blood plasma and blood corpuscles as a starting substrate after the anticoagulant treatment of fresh pig blood. The high-activity thrombin is prepared by the following steps of: freezing the blood plasma at low temperature; precipitating and collecting prothrombin; activating ions; purifying enzyme liquid and the like; and the high-activity pig blood protein hydrolysate is prepared by the following steps of: breaking the walls of the blood corpuscles; dissolving blood, performing segmental enzymolysis on complex enzyme; filtering and degerming and the like. The amino acid content of the pig blood protein hydrolysate prepared by the method accounts for over 80 percent of the protein, and the pig blood protein hydrolysate is easy to absorb and use. In the method, raw materialsare fully used and two high value-added products can be produced by feeding once. The whole production process saves high-toxicity organic solvents so as to overcome the defects of single product, solvent residues and the like and reduce production cost. By using the method, over 6,000U of thrombin competitive products and over 150g of high-activity pig blood protein hydrolysate powder can be prepared from1 L of pig blood.
Owner:江苏省江大绿康生物工程技术研究有限公司

Method for extracting plasma protein powder from pig blood

The invention provides a method for extracting plasma protein powder from pig blood. The method comprises the following steps of preparing anticoagulation pig blood; separating plasma from haemocyte; depositing the plasma to collect prothrombin; preparing crude thrombin liquid; preparing fine thrombin products; breaking walls and performing hemolysis of the haemocyte; performing enzymolysis of hyperglobulinemia by segment; preparing hydrolyzed protein of the pig blood. The method has the beneficial effects that the amino acid content of the hydrolyzed protein of the pig blood is more than 90% of protein, the hydrolyzed protein of the pig blood is easy to absorb and utilize, raw materials are fully utilized, and two high added-value products can be produced by once charging. In the whole process of production, organic solvents with large toxicity are not used, the defects of product singleness, solvent residue and the like are overcome, and the production cost is reduced.
Owner:HAIAN HUARUN FOOD

Passage method and application of human induced pluripotent stem cells

The invention relates to a passage method and an application of human induced pluripotent stem cells. The method solves the problems of easy cell differentiation, low transfection efficiency and difficult gene modification of traditional clone block passage methods. The method is a single cell passage and culture method, and comprises the following steps: fully digesting pluripotent stem cell clones to singe cells by using digestive enzyme added with a ROCK inhibitor; counting by using a blood counting chamber or a cell counter; spreading cells on an ECM coated culture plate according to a density of 20000-30000 cells / cm<2>; culturing the induced pluripotent stem cells by using a medium containing the ROCK inhibitor culture conditions comprising a temperature of 37DEG C and containing 8-15% of CO2; and passing 20 generations to obtain induced pluripotent stem cells with unchanged pluripotency including the expression of pluripotency genes, in vivo and in vitro differentiation potential and the like.
Owner:SHENZHEN SANQI BIOTECH

Method for extracting genome DNA of poultry

The invention discloses a method for extracting genome DNA of poultry, applied to large-scale collection, separation and purification of genome DNA of poultry in the actual production. Based on the condition that the poultry blood corpuscle contains a karyon, the method for extracting genome DNA of poultry in the invention proposes a principal that the DNA genome can be extracted once the poultry blood is taken out, completely saving the steps of anticoagulation and blood preservation; the method also proposes that blood is taken from the plantar vein, realizing simple and efficient blood sample collection and less stimulation to the poultry, and furthest avoiding reduction of egg and meal yield because of blood taking. The blood sample not more than 20mul in each poultry is taken on spot and then directly put into a 1.5ml centrifugal tube and mixed with the 700mul of poultry blood lysate in the centrifugal tube, put into an ice-cube box and taken back to the laboratory for DNA extraction; the whole process is secure and reliable, and biological security danger caused by massive poultry blood transport is reduced. Aiming at the problem that protein pollution easily occurs in the poultry blood extraction process, the method of the invention proposes that the DNA is extracted according to the original phenol method, but the saturated phenol is treated for two times and centrifuged at four degrees, thus the protein pollution is extremely reduced, the purification of the extracted DNA is much improved, and the subsequent molecular detection is much facilitated.
Owner:CHINA AGRI UNIV

Combined process ofr producing animal blood fiber protein

This invention has disclosed an animal blood fibre connecting albumens united craft of separating and distilling several kinds of biochemical materials such as FN, SOD, immunoglobulin (Ig) and hemachrome. Gathering the fresh animal's blood, it is anticoagulatory to add trisodium citrate, centrifugate rapidly, collect blood plasma and blood corpuscle separately, store it in the environment under 10 degrees, add ammonium sulphate to the blood plasma until the saturation is about 20 to 30 percent, put above l hour quietly, filter or hang filter, fetch the precipitate to get FN product, it has abundant material source and easy craft, suitable for large-scale production.
Owner:郑州德福恩生物技术有限公司

Serum-free human peripheral blood lymphocyte culture medium

The invention relates to a biological agent and particularly relates to a lymphocyte culture medium. The lymphocyte culture medium comprises lectin, a basal culture medium and a serum substitution, wherein the lectin is L-type phytohemagglutinin; the basal culture medium is an RPMI1640 basal culture medium; and the serum substitution comprises bovine serum albumin, recombinant human insulin, ferric citrate and an amino acid mother solution. By adopting the serum-free human peripheral blood lymphocyte culture medium, the animal or human serum is not used so that the cost of the culture medium is reduced and the disease dissemination risk is also reduced. The components of the serum-free human peripheral blood lymphocyte culture medium are determined so that the problems of complex traditional serum components, quality differences in different batches and fluctuated culture effect can be avoided. The culture medium provided by the invention is high in lymphocyte conversion rate and lymphocyte metaphase index, low in reagent cost and stable in quality, and the cultured cell can be used for clinical diagnosis of the karyotype analysis.
Owner:广州和能生物科技有限公司

Method for producing hemepeptide by using red blood cells of animal blood as raw materials

The invention discloses a method for producing hemepeptide by using red blood cells of animal blood as raw materials. The method comprises the following steps of: adding water into the red blood cells of the animal blood, stirring for wall breakage, heating, performing thermal denaturation, adjusting the pH of the obtained mixture to be between 7.5 and 9.0 at the temperature of between 40 and 60 DEG C, adding special enzyme 1122 for blood cell hydrolysis in a ratio of 1,000 to 2,500U / (g protein), performing enzymolysis for 4 to 8 hours with stirring, inactivating the enzyme, filtering, concentrating the filtrate, performing spray drying, and thus obtaining the hemepeptide. According to the method, the red blood cells are subjected to wall breakage and thermal denaturation, so that the double-spiral structure of the red blood cell protein becomes loose, the special enzyme 1122 for blood cell hydrolysis enters the amino acid binding sites in the red blood cell protein more easily to perform enzymolysis, and the enzymolysis rate is improved; and the adopted special enzyme 1122 for blood cell hydrolysis can be used for simultaneous enzymolysis of multiple amino acid binding sites of the red blood cell protein, so that the enzymolysis efficiency and the yield are further improved, and the yield of the whole hydrolysis process reaches over 78 percent.
Owner:赵运生 +3

Method for extracting superoxide dismutase (SOD) from pig blood

The invention discloses a method for extracting superoxide dismutase (SOD) from pig blood. The method comprises the following steps of separating blood cells from blood plasma by a separation-cleaning-disruption integrated one-step separation technology and preparing a blood solution, treating the blood solution by an ethanol-chloroform dissolution and precipitation technology to obtain a crude enzyme solution, treating the crude enzyme solution by an acetone precipitation method to obtain a SOD crude protein, heating supernate obtained by the previous step for degeneration, collecting supernate, removing precipitates, carrying out further separation and purification of the supernate by a spiral gradient elution technology to improve enzyme unit activity and obtain a purified SOD enzyme solution, filtering the purified SOD enzyme solution by a membrane for desalination, and carrying out freeze drying to obtain a purified SOD product. The method simplifies production technology and production equipment, and satisfies requirements of large-scale industrialized production.
Owner:天津宝迪农业科技股份有限公司

Method for preparation of deer blood heme by ultrasound and enzymolysis technologies

Belonging to the field of food biochemistry, the invention relates to a method for preparation of deer blood heme by ultrasound and enzymolysis technologies. The preparation method includes the steps of: (1) adding a trisodium citrate solution into fresh deer blood, stirring the substances evenly to obtain fresh anticoagulant deer blood, taking 100mL of the anticoagulant blood into a centrifugal tube, conducting centrifugation for 25min, pouring out the supernatant and collecting red blood cells, and performing washing by saline 3 times to obtain clean red blood cells, adding deionized water, conducting stirring by an electric mixer, letting the red blood cells absorb water and burst so as to separate hemoglobin from the red blood cells, filtering out fiber, and leaving the filtrate for standby use; (2) adding certain amount of water into the red blood cells in (1), and conducting crushing in ultrasonic equipment for some time; (3) adding alkaline protease of certain substrate concentration into the solution in (2), adjusting the temperature and pH, and carrying out enzymolysis; and (4) performing separation and freeze drying. Experiments prove that preparation of deer blood heme by ultrasound and enzymolysis technologies can reach an extraction rate of 72%, and the purity of a crude product can reach 31.2%.
Owner:HEILONGJIANG PROV WILD ANIMAL INST

Method for detecting hemagglutination inhibition antibody of chicken infectious bronchitis

The invention relates to the technical field of livestock vaccine, and in particular relates to a method for detecting a hemagglutination inhibition antibody of chicken infectious bronchitis. The method comprises the following steps: treating serum to be detected, namely, by taking kaoline suspension as a serum treatment liquid for treating serum to be detected, adding the supernate into chicken erythrocyte blood corpuscle mud so as to obtain serum which is diluted in a ratio of 1:4 and is to be detected; performing hemagglutination inhibition test, namely, adding 25mu l of the serum which is diluted in a ratio of 1:4 and is to be detected into 25mu l of antigen with 4HA units, and performing hemagglutination judgment. By adopting the negative serum treated by using a method for removing non-specific reaction of the serum, the infectious bronchitis hemagglutination inhibition evaluation titer is less than 1:4, and by adopting the infectious bronchitis positive serum treated by using the method, the infectious bronchitis hemagglutination inhibition evaluation titer is reduced by 0.5-1 titer, the non-specificity reaction is removed, and the accuracy of the infectious bronchitis hemagglutination inhibition experiment result is improved.
Owner:YEBIO BIOENG OF QINGDAO

Chorionic gonadotropin beta subunit microfluidic disc and use method thereof

The invention discloses a chorionic gonadotropin beta subunit microfluidic disc and a use method thereof. The chorionic gonadotropin beta subunit microfluidic disc comprises a microfluidic disc body. A microfluidic detection unit is installed on the microfluidic disc body and comprises a whole blood injection groove, a whole blood separation channel, a blood cell storage groove, a plasma conveying channel, a mixing / detection groove, a magnetic particle solution injection groove, a cleaning fluid injection groove, an outer magnet area, a waste liquid tank, a human chorionic gonadotropin beta subunit monoclonal antibody solution injection groove and a light-emitting substrate solution injection groove, wherein the magnetic particle solution injection groove is wrapped by a human chorionic gonadotropin beta subunit monoclonal antibody, the outer magnet area contains a magnet, and the human chorionic gonadotropin beta subunit monoclonal antibody solution injection groove is labeled by alkaline phosphatase. By means of the simple method, intelligent control of microfluid in the microfluidic disc can be achieved. Meanwhile, reaction solutions can be fully mixed, it is guaranteed that a reaction system is efficient, and quantitative detection of the hCG concentration in samples is quickly achieved. The microfluidic disc has the advantages of being easy to operate, high in detection sensitivity, accurate and reliable in result, good in repeatability and low in cost.
Owner:ZHEJIANG PUSHKANG BIOTECHNOLOGY CO LTD

Sampler

The present invention relates to a sampler which is capable of rapidly and easily separating blood corpuscles from blood, being operated conveniently, and directly using extracted plasma. According to one embodiment of the present invention, a sampler includes a chamber and a membrane guide. Here, the chamber includes an insertion unit having an insertion hole on one side, wherein the other side is opened, and an inner side includes a receiving space for receiving a sample. Additionally, one side of the membrane guide is combined to the membrane, and the membrane guide includes a channel wherein filtered materials, which are filtered through the membrane among the samples received in the receiving space, are moved in a gravitational direction.
Owner:NANOENTEK

Monoclonal antibody capable of resisting chlamys farrei particle blood corpuscle and preparation method thereof

The invention discloses a monoclonal antibody capable of resisting a chlamys farrei particle blood corpuscle. The monoclonal antibody, which is named as mouse hybridoma cell strain 6H7 and is secreted by hybridoma cells, is collected by China Center for Type Culture Collection with the collection number of CCTCC No. C201042 and the collection date is 24th April, 2010. The hybridoma cells with favor growth vigor have the characteristics of uniform size, full, perfectly round and transparent appearance and exuberant fission; after the hybridoma cells are subject to routine culture in a culture medium, the culture medium comprises a large quantity of the chlamys farrei with high purity, good valence and strong specificity; and the results of detections by an indirect immnnofluotesent method and a streaming immnnofluotesent method show that the chlamys farrei can be combined with the specificity of the chlamys farrei particle blood corpuscle. The invention can be used for studying the generation, differentiation and distribution of the particle blood corpuscle in the process of scallop embryonic development and the conversion and difference between immunologic functions of the particle blood corpuscle and blood corpuscle of other types.
Owner:OCEAN UNIV OF CHINA

Ganoderma lucidum bran feed

The invention discloses a ganoderma lucidum bran feed, which is prepared from the following raw materials in parts by weight: 10-20 parts of soybean, 15-30 parts of corn, 25-40 parts of wheat bran, 30-40 parts of rice bran and 3-6 parts of ganoderma lucidum strain. The feed is obtained by culturing and fermenting liquid ganoderma lucidum, so that the meat quality of the conventional domestic animals is achieved, and rich natural health-care factors such as ganoderma lucidum polysaccharides, karnosin and the like are contained simultaneously; ganoderma lucidum mycelia are rich in various pharmacological ingredients and organic germanium which has an anticancer function, so that the generation of interferon, the growth of interferon control cancel cells can be called, the oxygen carrying capacity of red blood cells is enhanced, metabolism is promoted, the organism immunity is enhanced, and the incidence rate is lowered; chemical substances such as mold preventing agents, antibiotics, hormones and the like are added into a formula, so that residue of toxic and harmful substances is avoided, the culturing process is simple and controllable, the culturing success rate is increased, the culturing period is shortened, and batch production is available; the feed has stable quality and low cost, and is suitable for culturing various animals; and the meat quality of cultured animals are enhanced, and most importantly, human body health is facilitated.
Owner:TIANJIN KEDA BIOLOGICAL TECH INST

Method for preparing ABP (antibacterial peptide) from porcine hemoglobin

The invention discloses a method for preparing an ABP (antibacterial peptide) from porcine hemoglobin. The method comprises steps as follows: porcine blood corpuscles are obtained through separation of porcine whole blood and then subjected to hemolysis, enzymolysis, decoloration, ultrafiltration, vacuum concentration and freeze-drying, and the ABP is obtained; the dosage of trypsin is 3000 U / g, and the enzymolysis reaction time is 4-6 h under conditions that the pH is 8 and the temperature ranges from 45 DEG C to 55 DEG C. The method for preparing the ABP from the porcine hemoglobin is low in cost and good in effect.
Owner:CHONGQING DOUHAO BIOTECH

Blood corpuscle detection and biochemical detection instrument and detection method thereof

The invention discloses a blood corpuscle detection and biochemical detection instrument and a detection method thereof. The detection instrument comprises a transfer module, a dilution liquid addition module, a hemolytic agent addition module, a cleaning agent addition module, a first detection cup, a second detection cup, a cleaning module, a uniform mixing module and a control module. The first detection cup is used for first dilution of a blood sample, simultaneous detection of leucocyte and ferrohemoglobin indexes in the same blood sample and detection of the other one biochemical component in the blood sample. The second detection cup is used for second dilution of a blood sample and detection of erythrocyte and platelet in the dilute blood sample. The detection instrument realizes fast blood routine detection and other biochemical component detection through the same biochemical detection instrument, has complete functions, realizes fast clinical urgent blood routine detection and biochemical index detection, has low sample consumption, has simple operation processes and produces few wastes.
Owner:SINNOWA MEDICAL SCI & TECH

Self-adjusting rotor used for conveying blood or conveying shear sensitive fluid

The invention relates to a self-adjusting rotor used for conveying blood or conveying shear sensitive fluid. The rotor rotates in a pump body so that the pressure of the fluid is increased and the fluid flows out along the circumferential direction relative to the flowing direction of a medium, the flowing direction comprises an incident flow face (3) and a back flow face (4), and an upper end face and a lower end face of the rotor are an upper oblique plane and a lower oblique plane; if the rotor is cut along a central axis, an included angle formed by an intersecting line of the upper oblique plane and a section and a rotary horizontal plane is an upper top angle beta, and the beta is more than 0 degree; an included angle formed by an intersecting line of the lower oblique plane and thesection and the rotary horizontal plane is a lower bottom angle alpha, and the alpha is more than or equal to 0 degree; the number of the rotors is even, and the rotors are symmetrically distributed along a rotating shaft; and rotor clearances are formed between the upper end face and the lower end face of the rotor and the pump body, the rotor clearances are the distances from each point on the upper end face and the lower end face to the inner surface of the corresponding pump body, and the rotor clearances from the incident flow face to the back flow face are reduced progressively. The self-adjusting rotor has extremely high self-balancing and self-adjusting properties. When the self-adjusting rotor is applied to an artificial heart, the rotor can reduce the damage to blood corpuscles,improve the compatibility with the blood, and lower the manufacturing cost.
Owner:钱逸

Biomarker for pre-employment screening of workers exposed to noise

The invention discloses a blood corpuscle gene marker detection method for workers exposed to noise. The biomarker is the rs77684420 locus and rs6726395 locus of a NFE2L2 gene; the rs77684420 locus ofthe NFE2L2 gene is shown as SEQ ID NO : 1-2 which is TGAAGGTTACCAATATATTAAATGC[C / T]GTGGAATCAACGATTTTTATGTTC; and the rs6726395 locus is shown as SEQ ID NO : 3-4 which is TTTAATTATTCCATCCTACCCAAGC[A / G]TACAGATGTTAGTGGATCAAATGAG. The method firstly extracts DNA from the blood corpuscle of workers in a control group matching the ages and genders of the works in a noise hearing loss group, four gene loci can be detected, and the correlation of rs77684420 locus at 5'UTR area of the NFE2L2 gene, rs6726395 locus in an intron area and haplotype GAGT polymorphism and noise hearing loss can be verified;and the gene marker taken as pre-employment screening of the workers exposed to noise is simple in operation, high in sensitivity and suitable for large scale screening of susceptible population, andtherefore, bases can be provided for the pre-employment screening of the workers exposed to noise.
Owner:SOUTHEAST UNIV

An anticancer medicinal composition, preparing method and use thereof

The invention belongs to medical domain; it has disclosed a compound medicine that contains cantharidin orits derivates and at least one kind of medicine that can improve the immunity, the preparing method and application is also mentioned in the invention. The medicine that can improve immunity is chosen from one kind or various kinds of lentinan, ganoderma and hoelen. The medicine can be used to treat liver cancer, esophageal cancer, carcinoma of gastric cardia, lung cancer, malignant lymphoma and low blood corpuscle; it can also be used to treat hepatitis, cirrhosis or HB virus; it can be used as preoperative drug for cancer operation or be used in combination chemotherapy with the function of coordinated synergistic action. The product in the invention has good stability and the effects have been greatly improved than the single application of Norcantharidin, lentinan, ganoderma and hoelen. The medicine can be made into any medically acceptable dosage with any medically acceptable accessories so it has wide prospects.
Owner:海安江理工技术转移中心有限公司

Pluripotent stem cells directional differentiation method

The invention discloses a pluripotent stem cells directional differentiation method. The method is characterized in that pluripotent stem cells are cultured under cell culture environment of non exogenous hematopoietic cytokines, non serum, non matrix cells and clear component, after embryoid is formed, a vascular endothelial growth factor and bone morphogenetic protein 4 are added, the embryoid is attached on the surface spread with collagen IV, mesoderm differentiation is induced, and hemopoietic progenitor cells and blood corpuscles are generated. The cell culture system with determined component enables directional differentiation on the pluripotent stem cells, has the advantages of low cost, simple operation, high repeatability and ordered differentiation process, can massively generate hemopoietic progenitor cells and blood corpuscles, and has important meaning for researching a blood growth process mechanism.
Owner:GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI

Kit for detecting alpha-1,3Gal antigen and application thereof

The invention relates to a detection kit, specifically to a kit for detecting alpha-1,3Gal antigen and application thereof. According to the invention, a solid phase antigen coated plate is prepared from Gal1,3Gal-BSA antigen in advance, and then the antibody competitive ELISA inhibition method detection kit is prepared through combination with the specific antibody M86 of the alpha-1,3Gal antigen. The kit provided by the invention is applicable to qualitative and quantitative detection of alpha-Gal antigen of a variety of biomaterials, especially to detection of residual alpha-Gal in animal-derived biomaterials. The specificity of the kit reaches 100%, and the sensitivity of the kit is embodied by capacity of detection of rabbit blood corpuscles with a concentration of 3.9 * 10<4> / ml and Gal antigen in a Gal antigen positive reference with a concentration of 6.25 mu g / ml.
Owner:NAT INST FOR FOOD & DRUG CONTROL

Method for correcting blood glucose value of blood sample

The invention discloses a method for correcting a blood glucose value of a blood sample. The method comprises the following steps: applying a first voltage to the blood sample, so as to obtain a first blood glucose value; applying a second voltage to the blood sample, so as to obtain a second blood glucose value; applying a third voltage to the blood sample, so as to obtain a hematocrit index of the blood sample; processing the hematocrit index and correcting the second blood glucose value. In the correcting process, the third voltage is higher than the first voltage. According to the method, at least three-phase voltages within a specific range are applied to the blood samples, so that sensing currents corresponding to the blood values and the hematocrit index corresponding to the blood sample can be obtained, and then the blood glucose concentration can be corrected and compensated according to the hematocrit index.
Owner:DELBIO

Deer blood protein polypeptide and application

The invention discloses a deer blood protein polypeptide. A preparation method thereof comprises the following steps: separation of blood corpuscles, ultrasonically assisting hemolysis, microwave-assisting alkali enzyme enzymolysis, microwave-assisting papain enzymolysis and concentrating. The molecule has higher uniformity, is high in oligopeptides proportion and is easily absorbed; the deer blood protein polypeptide has higher fatigue resistance and antioxidant activity and better effect; the deer blood protein polypeptide used for preparing healthcare wine has higher stability, is difficult to form precipitation or turbidity and has wide application prospect in the field of healthcare products.
Owner:深圳知本康业有限公司 +1

Flow cytometry detection method of nitric oxide level of shrimp blood corpuscles

InactiveCN103063634AAvoid handling damageSimple and fast operationFluorescence/phosphorescenceShrimpDaf fm da
The invention discloses a flow cytometry detection method of nitric oxide level of shrimp blood corpuscles. The flow cytometry detection method comprises the following steps of preparing shrimp blood corpuscle suspension liquid, co-culturing fluorochromes DAF-FM DA and shrimps blood corpuscles, and measuring DAF-FM average flourescence intensity of shrimp total blood corpuscles or blood corpuscles of different types through flow cytometry. The flow cytometry detection method is free from cell washing, avoids operation damage on the blood corpuscles, is high in accuracy, good in repeatability, large in measured quantity, simple, convenient and rapid to operate, and capable of analyzing cell nitric oxide level of different types at the same time, and provides a method basis for measuring the nitric oxide level of the shrimp blood corpuscles.
Owner:SOUTH CHINA NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More