Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

53 results about "Pre-employment screening" patented technology

Pre-employment screening. Pre-employment screening refers to the process of investigating the backgrounds of potential employees and is commonly used to verify the accuracy of an applicant's claims as well as to discover any possible criminal history, workers compensation claims, or employer sanctions.

System and method for developing and managing group social networks

A system and method for facilitating the configuration and management of events within a social networking system is disclosed. The system enables members of similar or different geographic region and / or like interests, hobbies, social status, relationship status, family status, etc. to interact with the system to view activities, register to participate in activities, and schedule activities. A personal workspace, accessible through a variety of devices (e.g., kiosks, web clients, wireless devices, and set-top boxes) enables network members to view a personal calendar, scheduled events and activities, invitations, localized news, and the like. The personal workspace further facilitates registration to participate in scheduled activities. A scheduling interface enables network users to configure and schedule activities through selection and / or entry of an activity details. The system further interacts with other systems to determine facility availability, facility costs, payment processing, perform background checks, synchronize calendars and contact lists, and the like.
Owner:INSTABUDDY

Systems and Methods for Qualified Registration

A product is sold at retail in an unusable state. Activation of the product does not require any steps be taken b y the retail seller. To activate the product, the purchaser uses a phone or personal computer to interact with a registration server for this type of product. Alter the consumer has provided sufficient identifying information, the registration server interacts with a qualification server that determines whether the purchaser meets the qualifications set for this type of product. For a weapon sale, this is typically a criminal background check. If qualified, the registration server receives an indication of qualification from the qualification server. The registration server and product communicate over a network to establish trust, store information in the product, and then activate the product. The product receives information via a network appliance, for example, a phone or personal computer. The receiver may sense sound from a speaker or light from a display of the network appliance. The product transmits information onto the network directly when the network appliance has a suitable receiver. Otherwise, the product provides the information to the purchaser who enters the information into a user interface of the network appliance. The user interface may perform voice recognition or accept data via a pointing device or keyboard. The serial number of the product is transmitted to the registration server. A description of the purchaser and / or qualification results are stored in the product.
Owner:AXON ENTERPRISE INC

Systems and methods for qualified registration

A product is sold at retail in an unusable state. Activation of the product does not require any steps be taken by the retail seller. To activate the product, the purchaser uses a phone or personal computer to interact with a registration server for this type of product. Alter the consumer has provided sufficient identifying information, the registration server interacts with a qualification server that determines whether the purchaser meets the qualifications set for this type of product. For a weapon sale, this is typically a criminal background check. If qualified, the registration server receives an indication of qualification from the qualification server. The registration server and product communicate over a network to establish trust, store information in the product, and then activate the product. The product receives information via a network appliance, for example, a phone or personal computer. The receiver may sense sound from a speaker or light from a display of the network appliance. The product transmits information onto the network directly when the network appliance has a suitable receiver. Otherwise, the product provides the information to the purchaser who enters the information into a user interface of the network appliance. The user interface may perform voice recognition or accept data via a pointing device or keyboard. The serial number of the product is transmitted to the registration server. A description of the purchaser and / or qualification results are stored in the product.
Owner:AXON ENTERPRISE INC

Ensuring the provenance of passengers at a transportation facility

The provenance of passengers intending to depart on a vehicle from a transportation facility, is ensured by providing biometric reading devices at both a check-in station and a departure area station of the facility. The name and / or other information concerning a passenger arriving at the facility is also entered for assessment into a background check system. A biometric template of the passenger is acquired by the reading device at the check-in station and forwarded to the departure area station. When the passenger appears at the latter station, a second biometric template is acquired by the reading device there. The second template is compared with each of a number of templates that were forwarded from the check-in station. If no match exists, or if the background check system returns an unsatisfactory assessment, the passenger is refused boarding onto the vehicle.
Owner:GLOBAL RAINMAKERS INC PUERTO RICO CORP +1

Ensuring the provenance of passengers at a transportation facility

The provenance of passengers intending to depart on a vehicle from a transportation facility, is ensured by providing biometric reading devices at both a check-in station and a departure area station of the facility. The name and / or other information concerning a passenger arriving at the facility is also entered for assessment into a background check system. A biometric template of the passenger is acquired by the reading device at the check-in station and forwarded to the departure area station. When the passenger appears at the latter station, a second biometric template is acquired by the reading device there. The second template is compared with each of a number of templates that were forwarded from the check-in station. If no match exists, or if the background check system returns an unsatisfactory assessment, the passenger is refused boarding onto the vehicle.
Owner:GLOBAL RAINMAKERS INC PUERTO RICO CORP +1

Dynamic Personal Privacy System for Internet-Connected Social Networks

Systems and methods of obtaining or providing search results in a computer-based social network in a manner that allows users to maintain a certain level of control over their privacy, and systems and methods of controlling undesired unsolicited communications between users in a computer-based social network. Users enter privacy settings which are used to filter search results by comparing privacy settings to available data concerning the searcher. Users are identified in the searches only if the searcher meets the privacy settings provided by the user. Privacy settings may include permission search terms, identification of a school, evaluating the number of connections of the searcher, evaluating a number or percentage of common connections between the user and the searcher, background checks, or a combination thereof as examples.
Owner:BOLIVEN

Web-based system and method for screening job candidates

InactiveUS20060224404A1Costly and time-consume practiceEasy to processOffice automationWeb sitePre-employment screening
A web-based system and method for screening job candidates comprising designing a website having essential screening components for one or more specific job openings. The screening components comprise a list of one or more job candidates who have been pre-qualified for a specific job opening according to designated screening components. One of the essential screening components listed on the web site is a video interview of the prescreened job candidate in combination with a resume and test results, if any, for the listed job candidate. The screening components further comprise background checks, credit checks, personality tests, skills tests, and drug tests. The results of administering the screening components are hyperlinked to the web page comprising the list of candidates. Accessibility to the web site is limited to authorized users.
Owner:KEUSSEYAN CARL

Systems and methods for matching and linking employees with employers of application-based positions

The present invention relates generally to the provision of a Website portal for matching potential applicants to employers who are seeking to fill application-based positions (e.g., hourly-wage or restaurant or retail or similar positions). An applicant portal is provided to collect information from the applicants, to store the applicant information in a database, and to allow the applicants to perform other tasks. An employer portal is provided to collect employer information, to store the employer information in an employer database, to allow employers to search the applicants, to allow the employer to view uploaded videos provided by the applicants, and to allow employers to run background checks on the applicants. An applicant information database is stored in connection with the website, such that potential employees may be optimally matched and linked / connected to the most appropriate employer.
Owner:MATCH LINK PARTNERS

Automated Extraction and Reporting on Applicant Private Social Network Information

A system and computer implemented method, in the case of pre-employment screening and where other commercial goods and services require review of an individual (ie an Applicant), wherein a Reviewer uses an automated, efficient permission based system to identify and access private and semi-private information of an Applicant maintained in their social network accounts, with particular benefit where these have privacy settings. The system initiates a Reviewer request, automates the Applicant's identification of and approval to their social network and automates the retrieval of relevant information and reporting to the Reviewer. The process can be initiated by either the Reviewer or the Applicant. The system filters for potential legally discriminatory protected class information from the Reviewer residing in social network accounts and returns relevant information in an efficient, automated and permission based manner.
Owner:POTTER KEVIN GRANT

RFID (Radio Frequency Identification Device) data transmission and authentication system and method

The invention discloses an RFID (Radio Frequency Identification Device) data transmission and authentication system and method. The RFID data transmission and authentication system comprises a checking reader-writer system at a user terminal and a background checking server system, wherein the checking reader-writer system at the user terminal comprises a checking reader-writer and an electronic tag; and the background checking server system comprises a checking server and a data center. Based on the data transmission and authentication system, the RFID data safe transmission and authentication method comprises the steps of a preparation stage of the electronic tag and a radio frequency identification field stage of the electronic tag. According to the RFID data transmission and authentication system and method, by using an electronic tag sleeping technology and combining with a private key encrypted EPC (Electronic Product Code), checking reader-writer identification and background server authentication as well as matching with a passive ultra-high frequency electronic tag, practicability for various kinds of special application occasions is enhanced, the security of target information is effectively protected, application cost is lowered, and RFID data security and a function of anti-counterfeiting identification are realized.
Owner:UNIV OF ELECTRONICS SCI & TECH OF CHINA

Resume ID System

A computer-operated method for distributing job-seeker qualifications to hiring entities comprises job-seeker registration and secure internet entry / uploading, of personal data into a program administrator server, to selectively populate one or more data fields, including a résumé module, a photo / video module, a verification module, and a pre-employment screening module. The job-seeker selects a distribution security scheme, which may include requiring a password to view data, and the program administrator encodes a bar code based upon inputted data and filter / security selections, and sends the bar code to the seeker, who forwards the bar code to one or more hiring entities, who use it and a password for online viewing of the seeker's personal data. The bar code is customizable to be hiring-entity-specific and to permit only selective viewing of the entire stored databank, and may also be subsequently disabled. The bar code facilitates seeker tracking of a time / date of data viewing.
Owner:KATZ HOWARD B +1

Mobile transaction devices enabling unique identifiers for facilitating credit checks

When a user is requested to provide the user's social security number (SSN) or other personal information for conducting a credit / background check, the user may use a mobile app on the user's mobile device to display a unique identifier which is used in place of the SSN for processing the user's credit / risk analysis. The unique identifier is used as a protection layer on top of a user's SSN to reduce chances of identity fraud. In particular, an unique identifier (token) may be generated and issued to current payment account holders or new payment account holders when they sign up for payment accounts. When a merchant requires a customer's social security number for performing a credit or background check on the customer, the customer may simply provide the unique identifier and may be cleared to start using the merchant service without exposing the customer's SSN.
Owner:PAYPAL INC

Electronic trigger lock apparatus and system

A system for preventing unauthorized access to a firearm trigger includes a database of PIN numbers associated with a plurality of trigger locks and access tokens, each corresponding trio represented by an identification code. At purchase, a purchased firearm includes a two-piece trigger lock along with an access token. Each token includes a unique configuration of ferro-magnetic wires. If a background check of the firearm purchaser is approved, a central computer coupled to the database and to a computer network displays a personal identification number (PIN). Entry of this PIN into a keypad on a corresponding trigger lock actuates a read head therein and a token may be positioned thereby. A processor coupled to the read head is able to determine if the trigger lock and token match and, if so, to release of the trigger lock.
Owner:SAPIA FRANCO

Electronic invoice checking printing system and method

The invention discloses an electronic invoice checking and printing system and method. The method includes the steps that the two-dimensional code information on an invoice or an extraction sheet is scanned through a two-dimensional code scanning module, and the two-dimensional code recognition module identifies the two-dimensional code on the invoice or the extraction sheet; an electronic invoiceextraction engine module determines the type of an electronic invoice platform that needs to be docked according to the type and content of the two-dimensional code, the image verification code of the electronic invoice platform is identified through a verification code identification module, and an electronic invoice file is obtained through the electronic invoice engine module after successfulidentification; the electronic invoice information on the electronic invoice file is extracted through an invoice information extraction module, and a background check module enters a national VAT invoice inspection platform of the State Administration of Taxation; the background check module checks the electronic invoice information, and a check result capture module captures the check result information. The method can complete the electronic invoice printing, checking and check result printing operation, and quickly and easily obtain the key information in the reimbursement process of the invoice.
Owner:任海鹏

Validation of fingerprint-based criminal background check results

A system for employers and other organizations desiring the results of fingerprint-based criminal history background checks to validate that the intended applicants' fingerprints were in fact used for the checks. This system includes: 1. A compatible method for capturing individual applicants' fingerprints for the purpose of conducting fingerprint-based criminal history background checks at collection points and means for transmitting the applicants' fingerprints and biographical data to an Automated Fingerprint Image System (AFIS); 2. A compatible device at the employer's location that captures an electronic image of one or more of the applicant's fingerprints and means for transmitting these fingerprints and biographical data to an Automated Fingerprint Image System (AFIS). These prints are captured solely for the purpose of validating that the applicants' fingerprints were captured at the collection points and were used for the criminal history background checks; and 3. An AFIS that: (1) stores the fingerprints and biographical data submitted for fingerprint-based criminal history background checks at one or more criminal history repositories, (2) stores the results of the fingerprint-based criminal history background checks, i.e., whether the applicant has a criminal history record, and (3) compares the validation prints with the prints submitted for the criminal history background check under the applicants' biographical data.
Owner:NAT BACKGROUND DATA LLC DELAWARE

Resume management method and system based on block chains

InactiveCN108875093AMeet authenticityMeet legalityOffice automationTransmissionPre-employment screeningMaterial resources
The invention provides a resume management method and system based on block chains. Based on multiple centralization of the block chains and tamper-proof and trustable characteristics, the techniquessuch as distributed data storage and encryption algorithm are utilized to conduct consensus signature and cochain on transaction data, real-time saved data form evidence chains through intelligent contracts, the requirements for reality, legality and relevance of the evidences are satisfied, and thus the standardization of personnel information is achieved; employment platforms take part in the process of resume authentication business, job-seeker resumes are provided with true, transparent and traceable business data sources, the employment platforms are helped to rapidly complete verification of the evidences and dispute setting, the manpower and material resources and time cost in the background checking process are lowered, the employment efficiency is improved, and the employment costis lowered; and meanwhile, the privacy of a job-seeker can be effectively protected, and the time and economic cost for employment application are lowered.
Owner:广州黄埔区块链培训中心有限公司

Computer-implemented animal shelter management system

The system provides templates which assist shelters in creating customized pet adoption applications and automatically scans responses to reject or flag applications with certain answers. The system tracks the application process, automatically assigns staff to review applications, maintains applicant denied / accepted lists, facilitates transfer of adoption documents, provides updated application status information, sends accepted applicants medical and other service related messages, provides animal transfer information and preforms automatic background checks. The system calculates estimated pet care costs and provides for instant pet registration at external registries. A software application for smartphones / tablets allows scanning of implanted GPS microchips, tracking of animal locations, proximity detection and identification of emergency rescue services proximate the location of the animal.
Owner:SQUISHYCUTE COM

Intelligent transformer station monitoring information step-by-step checking and accepting method based on three-layer double-network structure

The invention discloses an intelligent transformer station monitoring information step-by-step checking and accepting method based on a three-layer double-network structure, and the method comprises the steps: building an in-station background information checking and accepting point table for a target intelligent transformer station; dividing the monitoring information checking and accepting operation of the intelligent transformer station into two stages based on the in-station background information checking and accepting point table: carrying out the local simulation of an actual signal and in-station background checking and accepting, and enabling a process layer network to apply a digital signal and carrying out the remote monitoring checking and accepting; guaranteeing the full-coverage checking and accepting of information transmission links through the overlapping of measurement and control devices at the monitoring information transmission links at the two stages. The method can reduce the total monitoring checking and accepting time, can complete the remote monitoring checking and accepting operation in seven days after the connection of a remote channel, greatly shortens the time from the connection of the remote channel and the moment when the transformation station meets a use condition, guarantees the use time node, is high in checking and accepting quality, is short in checking and accepting time, and saves the manpower resources.
Owner:STATE GRID CORP OF CHINA +2

Background check method and system based on resume splitting, and computer storage medium

The invention discloses a background check method and system based on resume splitting, and a computer storage medium. The background check method comprises the following steps that: receiving a postrequirement and the resume of a job seeker, and processing the resume to obtain structured data, wherein the structured data changes the resume into different field information and stores the field information in a structured database; splitting the field information into multiple pieces of field information, and distributing to a plurality of background check execution parties; receiving an investigation result fed back from the background check execution parties; and extracting a mutually exclusive investigation conclusion in the investigation result to be subjected to secondary rechecking,and generating a final investigation report. The background check system is a system device for executing the above background check method, and the computer storage medium stores a computer executable instruction for executing the above background check method. By use of the method, the system and the computer storage medium, more accurate resume data can be provided, a resume splitting way is adopted to carry out cross validation on the resume result of an investigated person, the credibility of the investigation result is improved, and the employment risk of an employer is lowered.
Owner:考拉征信服务有限公司

Self-service consumption management all-in-one machine and control method thereof

The invention provides a self-service consumption management all-in-one machine and a control method thereof, and belongs to the technical field of equipment for self-service consumption. According to the self-service consumption management all-in-one machine and the control method thereof, a customer operating end is arranged; furthermore, a waiter operating end is arranged; and the waiter operating end provides the functions, such as background check and publishing of a new menu, for a merchant. The all-in-one machine inducts the rotation process of a host through an induction device; when the host rotates to pass through a set position, a processor switches a currently displayed client side; therefore, a touch screen displays the display interface of a customer client side while facing to a customer, and displays the display interface of a waiter client side while facing to a waiter; therefore, reasonable switching between different client sides is realized; and simultaneously, use requirements of the customer and the merchant can be satisfied.
Owner:广州方派科技有限公司

Biomarker for pre-employment screening of workers exposed to noise

The invention discloses a blood corpuscle gene marker detection method for workers exposed to noise. The biomarker is the rs77684420 locus and rs6726395 locus of a NFE2L2 gene; the rs77684420 locus ofthe NFE2L2 gene is shown as SEQ ID NO : 1-2 which is TGAAGGTTACCAATATATTAAATGC[C / T]GTGGAATCAACGATTTTTATGTTC; and the rs6726395 locus is shown as SEQ ID NO : 3-4 which is TTTAATTATTCCATCCTACCCAAGC[A / G]TACAGATGTTAGTGGATCAAATGAG. The method firstly extracts DNA from the blood corpuscle of workers in a control group matching the ages and genders of the works in a noise hearing loss group, four gene loci can be detected, and the correlation of rs77684420 locus at 5'UTR area of the NFE2L2 gene, rs6726395 locus in an intron area and haplotype GAGT polymorphism and noise hearing loss can be verified;and the gene marker taken as pre-employment screening of the workers exposed to noise is simple in operation, high in sensitivity and suitable for large scale screening of susceptible population, andtherefore, bases can be provided for the pre-employment screening of the workers exposed to noise.
Owner:SOUTHEAST UNIV

Systems and methods for computer- assisted evaluation and scoring

Systems and methods for computer-aided candidate evaluation using artificial intelligence to provide real time scoring, verification and evaluation. A server connected to a plurality of data sources and one or more end-user devices over a telecommunications network in a client-server architecture conducts identity verification, background checks, and examines credentials and qualifications.
Owner:VETTY INC

Method and apparatus for hiring workers

An apparatus, system and / or method that incorporates teachings of the present disclosure may include, for example, transmitting to a human resources system application information and permission to perform a background check for a job opening, where the application information and the permission are inputted by an applicant via a user interface of a time clock device, presenting a job offer from the human resources system to the applicant via a graphical user interface, receiving an acceptance of the job offer inputted by the applicant via the user interface to make the applicant a worker, capturing work time information for the worker via the user interface, and transmitting the work time information to a payroll system. Other embodiments are disclosed.
Owner:EPAY SYST

NFC (near field communication) technology based electronic ordering system

The invention discloses an NFC (near field communication) technology based electronic ordering system, which comprises an NFC tag, an intelligent mobile phone, a server and an embedded computer, and is characterized in that the intelligent mobile phone is provided with an NFC reading module, a display module and a wireless network module, the server is used for deploying an ordering web page and a background web page and providing web services, and the embedded computer is used for checking the background web page. An ordering web site and dining table parameters are written into the NFC tag, near-field induction is carried out on the NFC tag by using the intelligent mobile phone so as to read the web site and parameter information stored in the NFC tag, the ordering web site is opened by a web browser, an ordering operation is carried out on a touch display screen, ordering information is sent to the web server through the mobile phone, and the web server is used for deploying the ordering web page, the background checking web page and a database. According to the invention, the electronic ordering web site is accessed quickly through NFC tag induction, so that users need not to carry out a tedious operation of inputting the web site or using a dedicated APP. The NFC technology based electronic ordering system can effectively reduce the cost of the whole system.
Owner:SOUTH CHINA UNIV OF TECH

System and method for screening and processing applicants

Disclosed are systems and methods for performing efficient job applicant screening. In particular, a network-based system is established for gathering applicant information from an applicant remotely. Analysis of the received information is performed and evaluated pursuant to a first level of screening that can be done without excessive use of resources. Upon passing the first level screening, background checks and / or interviews, which require substantial resources, are further conducted. Applicants who pass the first level of screening are scheduled for interviews, including the optional initiation of personal interviews via video chat.
Owner:LIFEWORX

Multi-unit pre-approval for rental properties

A system and method for providing pre-approval of rental units enables a user to select multiple properties for which to apply for pre-approval. The system generates separate screening requests for each selected property based on personal information provided by the user and approval requirements specific to each selected property. The user is screened for each property in accordance with the approval requirements for that corresponding property. A unique identifier for the user is maintained and tracked so that a single credit or background check on the user is performed and results from those checks are used for multiple screening requests for different properties. The screening results are provided to the user along with an approval code for those properties for which the user is approved. A property can utilize the approval code to validate that the user is already approved for that property.
Owner:RENTSAFARI COM INC