A mutant of rhd blood group antigen rhd-g353a and its detection
A technology of blood group antigens and mutants, applied in the field of molecular biology, can solve problems such as inability to obtain correct results and difficult judgment of results, and achieve the effect of extensive scientific research and application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0011] Attached below Figures 1 to 2 The present invention is described further.
[0012] A RhD blood group antigen RHD-G353A mutant RHD1058G>C allele, wild-type RHD gene such as sequence SEQ ID NO: 1, mutant RHD gene such as sequence SEQ ID NO: 2; compared to wild-type RHD gene , the mutant RHD gene has a gene site mutation of g.25306714G>C, that is, the 80th base G of the mutant RHD gene sequence is mutated to C; the amino acid sequence transcribed from the wild-type RHD gene sequence is SEQ ID NO: 5, the amino acid sequence transcribed from the mutant RHD gene sequence is SEQ ID NO: 6, wherein the 353rd position of the amino acid sequence SEQ ID NO: 6 is changed from glycine G to alanine A.
[0013] SEQ ID NO:1
[0014] ATCATGGGCTACAACTTCAGCTTGCTGGGTCTGCTTGGAGAGATCATCTACATTGTGCTGCTGGTGCTTGATACCGTCG G AGCCGGCAATGGCATGTGGGTCACTGGGCTTACCCCCATCCCCTTAACACTCCCCTCCAACTCAGGAAGAAATGTGTGCAGAGTCCTTAGCTGGGGCGTGTGCACTCGGGGCCAGGTGCTCAGTAGGCTTCGGTGAATATTGTTGGCTGATTTATTCAGAAATTCTGTCCAG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



