Rh blood type DEL type RHD1073T>A allele and application thereof
A rh blood type and gene technology, applied in the field of molecular biology, can solve the problems of not being able to obtain correct results, not suitable for large-scale clinical application, and unstable results, and achieve the effect of extensive scientific research and application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0012] Attached below Figures 1 to 2 The present invention is described further.
[0013] A Rh blood type DEL type RHD1073T>A allelic mutation gene, the mutation occurs at the 25306729 position of chromosome 1, the number of this gene in the NCBl reference database GRCh38.p13 is NC_000001.11 (25272393-25330445), wild type The RHD gene is shown in SEQ ID NO:1, and the mutant RHD gene is shown in SEQ ID NO:2; compared with the wild-type RHD gene, the mutant RHD gene is mutated from base T to base at position 158 of the gene sequence Base A.
[0014] SEQ ID NO:1
[0015] GCTTATAATAACACTTGTCCACAGGGGTGTTGTAACCGAGTGCTGGGGATTCCCCACAGCTCCATCATGGGCTACAACTTCAGCTTGCTGGGTCTGCTTGGAGAGATCATCTACATTGTGCTGCTGGTGCTTGATACCGTCGGAGCCGGCAATGGCA T GTGG GTCACTGGGCTTACCCCCCATCCCCTTAACACTCCCCTCCAACTCAGGAAGAAATGTGTGCAGAGTCCTTAGCTGGGGCGTGTGCACTCGGGGCCAGGTGCTCAGTAGGC TTCGGTGAATTTGTTGGCTGATTTATTCAGAAATTCTGTCCAGCCCCTACCTTG GATGGATTTATCACCTCTCCAGGCCACCTCTTCTTTCCA
[0016] SEQ ID NO:2
[0017] GCTTATAAT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



