Unlock instant, AI-driven research and patent intelligence for your innovation.

rhd-t268a mutant and its detection

A technology of RHD-T268A and mutants, applied in the field of molecular biology, can solve the problems of inability to obtain correct results and difficult to determine the results, and achieve the effect of extensive scientific research and application value

Active Publication Date: 2020-12-01
WUXI NO 5 PEOPLES HOSPITAL
View PDF30 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, serological techniques have certain limitations
Due to the influence of disease or other factors, it is difficult to judge the results of red blood cells in some individuals during serological typing; the serological results of patients with chronic long-term blood transfusion sometimes show the phenomenon of "mixed vision"; when red blood cells cannot be obtained or the red blood cell samples are insufficient, Such as fetal blood type identification, forensic identification of remnants, etc., serological testing can not obtain correct results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • rhd-t268a mutant and its detection
  • rhd-t268a mutant and its detection
  • rhd-t268a mutant and its detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0011] Attached below Figures 1 to 2 The present invention is described further.

[0012] A RhD blood group antigen RHD-T268A mutant refers to the mutation occurring at the 25303322 position of chromosome 1, the 257th base A is mutated to G, and the wild-type RHD gene is shown in SEQ ID NO: 1 sequence, The mutant RHD gene is shown in the sequence of SEQ ID NO: 2; the number of this gene in the NCB1 reference database GRCh38.p13 is NC_000001.11 (25272393-25330445). The wild-type amino acid sequence of the coding sequence of the RHD gene is shown in SEQ ID NO: 5, wherein the amino acid change is from threonine T to alanine A at position 268 of the sequence of SEQ ID NO: 6.

[0013] SEQ ID NO:1

[0014] GACTTCCCAGCTCATTCCCTAAATGCTGCACAATCAGGGTAACTGTGTCCTGAGCCTAAGAGGCAGTAGTGAGCTGGCCCATCATGTCCACTGATGAAGGACACGTAGCCCCAACACAGGGGAGAAGTGGTTTCAGGATCAGCAAAGCAGGGAGGATGTTACAGGGTTGCCTTGTTCCCAGCGTGCCGGTCACTTGCAGCAAGGATGGTGTTCTCACTTCACTTCCT A CTTATGTGCACACGTGCGGTGTTGGCAGGAGGCGTGGCTGTGGGTAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses RhD blood group antigen RHD-T268A mutant RHD802A>G allele. A wild type RHD gene is shown as SEQ ID NO: 1, and a mutant type RHD gene is shown as SEQ ID NO: 2. A specific primerused for detecting the RhD blood group antigen mutant is also disclosed; the upstream primer is shown as SEQ ID NO: 3, and the downstream primer is shown as SEQ ID NO: 4. Through the RHD-T268A mutantand detection thereof, highly sensitive and accurate detection of the presence of the mutant genes in gene banks can be achieved.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a RHD-T268A mutant and its detection. Background technique [0002] The Rh blood group is the most complex and polymorphic system in the human erythrocyte blood group system, and it is also the main erythrocyte blood group that causes clinical transfusion reactions and severe hemolytic disease of the newborn. At present, more than 50 kinds of Rh blood group antigens have been found, among which the RhD antigen has strong immunogenicity and is encoded by the RHD gene, which is the focus of blood group research. Clinically, according to whether the D antigen is detected on the surface of the red blood cell membrane, the Rh blood group antigen is divided into two categories: RhD positive and RhD negative. [0003] At present, the routine detection method of Rh blood group D antigen is identified by serological saline method, indirect antiglobulin test and absorption and e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C12N15/11C12Q1/6876C07K14/47
CPCC07K14/47C12Q1/6876C12Q2600/156
Inventor 顾娟王玥苹邵超鹏王保龙马静姬艳丽
Owner WUXI NO 5 PEOPLES HOSPITAL