rhd-t268a mutant and its detection
A technology of RHD-T268A and mutants, applied in the field of molecular biology, can solve the problems of inability to obtain correct results and difficult to determine the results, and achieve the effect of extensive scientific research and application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0011] Attached below Figures 1 to 2 The present invention is described further.
[0012] A RhD blood group antigen RHD-T268A mutant refers to the mutation occurring at the 25303322 position of chromosome 1, the 257th base A is mutated to G, and the wild-type RHD gene is shown in SEQ ID NO: 1 sequence, The mutant RHD gene is shown in the sequence of SEQ ID NO: 2; the number of this gene in the NCB1 reference database GRCh38.p13 is NC_000001.11 (25272393-25330445). The wild-type amino acid sequence of the coding sequence of the RHD gene is shown in SEQ ID NO: 5, wherein the amino acid change is from threonine T to alanine A at position 268 of the sequence of SEQ ID NO: 6.
[0013] SEQ ID NO:1
[0014] GACTTCCCAGCTCATTCCCTAAATGCTGCACAATCAGGGTAACTGTGTCCTGAGCCTAAGAGGCAGTAGTGAGCTGGCCCATCATGTCCACTGATGAAGGACACGTAGCCCCAACACAGGGGAGAAGTGGTTTCAGGATCAGCAAAGCAGGGAGGATGTTACAGGGTTGCCTTGTTCCCAGCGTGCCGGTCACTTGCAGCAAGGATGGTGTTCTCACTTCACTTCCT A CTTATGTGCACACGTGCGGTGTTGGCAGGAGGCGTGGCTGTGGGTAC...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap