Method for quickly building CRISPR gene editing liver cancer cell strain and cell strain

A liver cancer cell, gene editing technology, applied in the field of gene editing targeting tumor cells, can solve problems such as unsatisfactory efficiency

Pending Publication Date: 2020-06-09
DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
View PDF7 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the efficiency of obtaining gene-edited positive cell lines from liver cancer cell lines introduced with sgRNA and Cas9 through drug screening is far from ideal. The high-efficiency cell monocloning is the technical progress of the present invention to overcome this obstacle, and it will provide a basis for the rapid establishment of gene-edited liver cancer cells in the future. Cell lines lay a solid foundation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quickly building CRISPR gene editing liver cancer cell strain and cell strain
  • Method for quickly building CRISPR gene editing liver cancer cell strain and cell strain
  • Method for quickly building CRISPR gene editing liver cancer cell strain and cell strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1. Using optimized CRISPR / Cas9 technology to construct LM3 liver cancer cell line with knockout of CPQ gene

[0054] (1) With the Lentivirus V2 vector (Zhang Feng Lab, MIT) as the basic skeleton, the genome sequence of the human CPQ gene was downloaded from NCBI and the structure was analyzed to find the transcription start region, and a pair was selected based on the online design of this region sgRNA, its upstream and downstream sgRNA sequences are as follows:

[0055] sgRNA1 CTTATCTTCGCATTTTTCGG(TGG)

[0056] sgRNA2 CAGAAGTGCCAATCGCTCAT(AGG)

[0057] Among them, the three bases in brackets are the PAM domain (NGG)

[0058] The sequences of four primers were designed as follows:

[0059] KOCPQ primer I (sgRNA1 sequence is underlined)

[0060] 5′-CGTCTCGCACCGCTTATCTTCGCATTTTTCGGgttttagagctaGAAAtag-3′

[0061] KOCPQ primer II

[0062] 5′-CAAAAAAGCACCGACTCGGTGCCACTTTTTTC-3′

[0063] The first PCR uses primers primer I and primer II to obtain a PCR product ...

Embodiment 2

[0097] Embodiment 2, the establishment of stably knocking out the MTDH gene LM3 cell line, the specific implementation steps are as follows:

[0098] (1) Construction of a plasmid for knocking out the MTDH gene. The two pairs of sgRNA sequences are:

[0099] first pair:

[0100] MTDH primer I 5'-CGTCTCGCACCGGAAATGCTCTCGGTCGGCCTGTTTTAGAGCTAGAAATAG-3';

[0101] MTDH primer IV

[0102] 5'-CGTCTCCAAACAGCGCCCGCAAAAAGCGGAGGCGGTGTTTCGTCCTTTCCAC-3'.

[0103] Second pair:

[0104] MTDH 2primer I

[0105] 5'-CGTCTCGCACCGAAATGGGCGGACTGTTGAAGGTTTTTAGAGCTAGAAATAG-3';

[0106] MTDH 2primer IV

[0107] 5'-CGTCTCCAAACATAGTGGATGGGTGGTAAAAGCGGTGTTTCGTCCTTTCCAC-3'.

[0108] After extracting the knockout MTDH gene recombinant plasmid obtained in the present invention and measuring the concentration of the plasmid with NanoDrop1000, the integrity of the plasmid is detected by electrophoresis.

[0109] (2) 24 hours before cell transfection, inoculate a cell density of 8×10 in a 100 mm cultur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for quickly building a CRISPR gene editing liver cancer cell strain. According to the method disclosed by the invention, a CRISPR / Cas 9 technique is improved, recombinant plasmids better in expression efficiency are constructed, quick monoclone culture is combined, and a stable gene knockout liver cancer cell strain is constructed. Required sgRNA is accurately obtained through primer synthesis, an inserting fragment is synthetized through two-step PCR, a carrier is loaded, and recombinant plasmids for knockout are constructed; after slow viruses are packaged, the packaged slow viruses and liver cancer cells are co-incubated, and sgRNA and Cas9 proteins of equal quantity are transmitted into the liver cancer cells at the same time through slow virus mediating; and liver cancer cells after gene editing are subjected to puromycin resistance screening and monoclone culture, and finally, a gene knock-out positive stable liver cancer cell strain is quickly obtained. According to the method disclosed by the invention, important experimental materials are provided for researching a molecular mechanism of the gene in generation and development of tumors, andreference is provided for in vitro cell modeling of liver cancer diseases.

Description

technical field [0001] The present invention relates to the field of gene editing targeting tumor cells in the field of biomedical research, specifically, the present invention relates to a method for rapidly obtaining gene-edited liver cancer cell lines. Background technique [0002] Liver cancer is the cancer with the second highest mortality rate in the world. In my country, the morbidity and mortality of liver cancer are very high, seriously endangering the health and quality of life of the people. Therefore, the study on the pathogenesis of liver cancer has become one of the hot spots in the study of tumor biology. Liver cancer is a disease of genetic abnormalities. Hundreds or thousands of mutations are formed in cancer cells, which makes it difficult for DNA sequencing technology to identify cancer-causing mutation genes. In addition, many liver cancer regulatory genes are difficult to discover by sequencing because they are not mutated but are otherwise deregulated...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/90C12N15/867C12N5/10
CPCC12N15/907C12N9/22C12N15/86C12N5/0693C12N2740/15043C12N2510/00
Inventor朴海龙李同明
OwnerDALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI