SgRNA and plasmid group of targeted IL-16 gene, gene knockout method and application thereof
A technology of plasmid and gene, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] A plasmid set for knocking out the IL-16 gene, the construction method is as follows:
[0052] (1) After px330 was digested with BbsⅠ, the main large fragment was recovered from the gel for later use.
[0053] (2) The designed sgRNA is as follows:
[0054] sgRNA1-S: CACC GCAGCTGGCAGACACATCGG (SEQ ID No. 1);
[0055] sgRNA1-A: AAAC CCGATGTGTCTGCCAGCTGC (SEQ ID No. 2);
[0056] The sgRNA1-S and sgRNA1-A were annealed separately to form a double-stranded structure containing BbsI cohesive ends. 10 μl system, containing 1 μl annealed PBbuffer, 1 μl each of sgRNA1-S and sgRNA1-A (the concentration is 100 μmol L -1 ), annealed at 95°C for 5 minutes, and set aside.
[0057] (3) Ligation: 10 μl system, containing 50 ng of vector, 10:1 molar ratio of insert fragment to vector, 1 μl of T4Buffer, 1 μl of T4 ligase, overnight at 16°C.
[0058] (4) Transform the ligation product, pick clones for sequencing identification, and obtain sgRNA1-S plasmid and sgRNA1-A plasmid.
...
Embodiment 2
[0098] Using the same method as in Example 1 to construct a plasmid set, the only difference is that sgRNA is as follows:
[0099] sgRNA2-S: CACC GCTGCTCAACTCCAAGCAGC (SEQ ID No. 3);
[0100] sgRNA2-A: AAAC GCTGCTTGGAGTTGAGCAGC (SEQ ID No. 4).
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



