Optimization method for realizing optimal sequence of low-cost high-flux nucleic acid aptamers based on label-free hybridization probe competition method
A nucleic acid aptamer and hybridization probe technology, applied in the field of molecular biology, can solve problems such as complex operation, high cost, and low throughput, and achieve high throughput, improved accuracy, and simple characterization methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0044] Example of a sequence optimization method for implementing ochratoxin A aptamers: see figure 1 , is a schematic flowchart of an optimization method for achieving the optimal sequence of a low-cost high-throughput nucleic acid aptamer based on the label-free hybridization probe competition method according to the present invention. It mainly includes the following steps:
[0045] 1. Select the optimal complementary region and the optimal complementary short-chain probe
[0046] The obtained OTA aptamer sequence is TGGTGGCTGTAGGTCAGCATCTGAT CGGGTGTGGGTGGCGTAAAGGGAGCATCGGACAACG (SEQ ID NO.1), a total of 61 bases, which are divided into 3 regions, each containing 20 bases.
[0047] In actual experiments, it was found that the first 20 bases of this sequence were primers, and its complementary sequence did not respond to different concentrations of OTA, so the complementary region was set in the last 42 bases (in order to meet the requirements of each cut 3 bases, 1 more T...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


