Optimization method for realizing optimal sequence of low-cost high-flux nucleic acid aptamers based on label-free hybridization probe competition method

A nucleic acid aptamer and hybridization probe technology, applied in the field of molecular biology, can solve problems such as complex operation, high cost, and low throughput, and achieve high throughput, improved accuracy, and simple characterization methods

Active Publication Date: 2020-07-24
DALIAN UNIV OF TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The technical problem to be solved by the present invention is to overcome the problems of complex operation, low throughput, and high cost in the prior art, and provide a method based on label-free hybridization probe competition to achieve low-cost, high-throughput nucleic acid aptamer optimal sequence optimization method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Optimization method for realizing optimal sequence of low-cost high-flux nucleic acid aptamers based on label-free hybridization probe competition method
  • Optimization method for realizing optimal sequence of low-cost high-flux nucleic acid aptamers based on label-free hybridization probe competition method
  • Optimization method for realizing optimal sequence of low-cost high-flux nucleic acid aptamers based on label-free hybridization probe competition method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0044] Example of a sequence optimization method for implementing ochratoxin A aptamers: see figure 1 , is a schematic flowchart of an optimization method for achieving the optimal sequence of a low-cost high-throughput nucleic acid aptamer based on the label-free hybridization probe competition method according to the present invention. It mainly includes the following steps:

[0045] 1. Select the optimal complementary region and the optimal complementary short-chain probe

[0046] The obtained OTA aptamer sequence is TGGTGGCTGTAGGTCAGCATCTGAT CGGGTGTGGGTGGCGTAAAGGGAGCATCGGACAACG (SEQ ID NO.1), a total of 61 bases, which are divided into 3 regions, each containing 20 bases.

[0047] In actual experiments, it was found that the first 20 bases of this sequence were primers, and its complementary sequence did not respond to different concentrations of OTA, so the complementary region was set in the last 42 bases (in order to meet the requirements of each cut 3 bases, 1 more T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology, and relates to an optimization method for realizing an optimal sequence of low-cost high-flux nucleic acid aptamers based on a label-free hybridization probe competition method. The method comprises the following steps: proposing an affinity evaluation standard, selecting a complementary short-chain probe position, optimizing the base numberof the complementary short-chain probe, and optimizing the optimal sequence of the nucleic acid aptamers and the like. The optimization method for realizing the optimal sequence of the low-cost high-flux aptamers based on the label-free hybridization probe competition method provided by the invention can be used for optimizing aptamers of any type of targets; and the method aims at different targets or different nucleic acid aptamers, and the characterization method is simple, low in cost and high in flux.

Description

technical field [0001] The invention belongs to the field of molecular biology, and relates to an optimization method for realizing the optimal sequence of a low-cost high-throughput nucleic acid aptamer based on a label-free hybridization probe competition method. Background technique [0002] Nucleic acid aptamer (Aptamer, also translated as nucleic acid recognition body, nucleic acid aptamer, aptamer) refers to the method of systematic evolution of ligands by exponential enrichment (SELEX), from artificially synthesized DNA Or single-stranded oligonucleotides screened from RNA libraries that can bind to targets with high affinity and recognize with high specificity. The basic sequence structure of the random library includes: the length of the middle random sequence is 35-60 bases, and the length of the primers used for amplification at both ends is about 20 bases respectively. The total length of the finally screened nucleic acid aptamers is about 60-100 bases. [0003...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G16B30/00G16B25/20
CPCG16B30/00G16B25/20
Inventor杨成张亚旗曲瑶
OwnerDALIAN UNIV OF TECH