Fusion protein of chemoattracting small peptide and dual specific antibodies

A bispecific antibody and fusion protein technology, applied in the direction of anti-animal/human immunoglobulin, hybrid immunoglobulin, anti-receptor/cell surface antigen/cell surface determinant immunoglobulin, etc., can solve the problem of effector cells Limited quantity, difficulty in getting the most out of the role, etc., to achieve the effect of great application prospects

Inactive Publication Date: 2009-04-22
BEIJING ABT GENETIC ENG TECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the number of effector cells enriched in the tumor site is limited after all, making it difficult to maximize this effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein of chemoattracting small peptide and dual specific antibodies
  • Fusion protein of chemoattracting small peptide and dual specific antibodies
  • Fusion protein of chemoattracting small peptide and dual specific antibodies

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Construction of vector pTCMBO.

[0044] (1) Treatment of vector pTMF.

[0045] The construction process of PTMFMH. Firstly, the vector pTMF (the vector pTMF is derived from the vector pET28a(+) (Novagen Company), which is constructed by replacing the multiple cloning site of the vector pET28a(+) with a segment of multiple cloning sites synthesized by our company, see reference 30) with Digest with restriction endonuclease BamHI (Bao Bioengineering (Dalian) Co., Ltd., the same below), as follows: take 18 μl of vector pTMF, 1.5 μl of BamHI, 3 μl of K buffer, and use ddH 2 O to make up the volume to 30 μl, and enzymatic hydrolysis reaction in 37°C water bath for 4 hours. Purify and recover the enzyme-digested DNA according to the instructions of the Small Volume Gel Recovery Kit (product of Huashun Biotechnology Co., Ltd., the same below). The recovered product was digested with Bpu1102I, specifically as follows: pTMF 16 μl, Bpu1102I 1.5 μl (purchased from Tr...

Embodiment 2

[0065] Example 2: Construction of vector p18TBHL

[0066] Preparation of chemokine 18 peptide

[0067] According to the sequence of SLC, design and synthesize two complementary chains that generate N-terminal 18 peptides

[0068] etup 5'agcgatggtgcacaggattgctgcctgaaatatagccagcgtaaaattccg3'

[0069] etdown 5'ctcgagagaaccaccaccaccagaaccaccaccacccggaattttacgctggctata 3' two complementary strands were amplified by PCR to obtain a complementary double strand containing restriction site XhoI at the 3' end. For specific operations, refer to the Molecular Cloning Guide. The PCR product was recovered with a mini-gel recovery kit. The recovered PCR product was subjected to XhoI single enzyme digestion, and the enzyme digestion reaction was referred to the product manual, and the enzyme-digested fragment was purified and recovered with a small gel recovery kit.

[0070] Processing of vector pTCMBO

[0071] The vector pTCMBO was first digested with NcoI (purchased from Treasure Bioengi...

Embodiment 3

[0079] Example 3: Low temperature-induced intracellular soluble expression of p18TBHL

[0080] (1) Transform p18TBHL into Escherichia coli BL21(DE3)

[0081] According to the method for preparing competent cells described in (4) of Example 1, competent cells of Escherichia coli BL21(DE3) (Invitrogen Company) were prepared. The plasmid p18TBHL was extracted according to the instructions of the plasmid extraction kit (Shanghai Huashun Company), and the transformation experiment was carried out according to (5) of Example 1.

[0082] (2) Low temperature induced expression

[0083] Coat BL21(DE3) containing p18TBHL on LB-K plate, culture overnight at 37°C, then pick a single clone, inoculate it in 5ml LB-K liquid medium, and culture it overnight on a shaker at 37°C in a large test tube (200 rpm / minute). The next day, take the overnight culture and transfer it to 250ml LB-K liquid medium at a ratio of 1 / 100, and continue to culture on a shaker at 37°C (200 rpm) to A 600 =0.6, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention relates to a fusion protein of chenotactic peptide and bispecific antibody against ovarian carcinoma and CD3 molecules. The fusion protein is constructed by sequentially connecting N-terminated 18-peptides of secondary lymphoid tissue chemokine, (GGGGS)2 linking peptide, and the bispecific antibody against ovarian carcinoma and CD3 molecules. C-myc label and His6 label are connected at the C-terminal. This invention also relates to the method for constructing, expressing and purifying the fusion protein, its coding sequence, its relevant expression vector, and the host cells containing the expression vector.

Description

technical field [0001] The present invention relates to the field of genetically engineered antibodies, and more specifically, relates to the combination of an N-terminal octadecapeptide of a chemokine SLC (Secondary lymphoid tissue chemokine) and an anti-ovarian cancer × anti-CD3 bispecific antibody The fusion protein; the method for constructing, expressing and purifying the fusion protein; the vector containing the fusion protein and Escherichia coli host bacteria. Background technique [0002] With the development of antibody engineering, immunotherapy is another important method for treating tumors after surgery, radiotherapy, and chemotherapy. The ideal treatment plan should be aimed at the specific and efficient killing of tumor cells, that is, bispecific antibodies that can bind to target tumor cells and highly cytotoxic effector cells are ideal candidates for this plan. On the one hand, it targets tumors to achieve specific combination with target tumor cells; on t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K16/46C07K7/00C07K16/30C07K1/14C07H21/00C12N5/10
Inventor黄华樑宋景震王祥斌春雷朴锦华张众林晴
OwnerBEIJING ABT GENETIC ENG TECH