Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for constructing klebsiella with deleted capsula

A technology for Klebsiella and capsule, which is applied in the field of constructing Klebsiella with missing capsule, can solve the problem of no detection, etc., and achieve the effects of improving the filtration speed, reducing the extraction cost and reducing the viscosity

Active Publication Date: 2009-04-01
TSINGHUA UNIV +1
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Under anaerobic conditions, 5g / L glucose was used as the carbon source, and the medium supplemented with vitamin B12 was also fermented, but after 48 hours of cultivation, no 1,3-propanediol was detected in the fermentation broth
[0019] There is no report on the construction of capsule-deleted Klebsiella for 1,3-propanediol fermentation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing klebsiella with deleted capsula
  • Method for constructing klebsiella with deleted capsula
  • Method for constructing klebsiella with deleted capsula

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0049] (1) Wild strain: Klebsiella pneumoniae HR521

[0050] (2) Construction of genetically engineered bacteria integrating terminators

[0051] ① Genomic DNA of Klebsiella pneumoniae HR521 was extracted and purified. Using the purified genome sample as a template, design primer 1: ACTCCCAATTGTGACCGAAATCC and primer 2:

[0052] GAGCCACTGGTTCCAGAACTTCA, carry out PCR (polymerase chain reaction) amplification experiment, PCR product CPS3 is sequenced, the result is as follows:

[0053] ACTCCCAATTGTGACCGAAATCCCGTAAACTTAACGCCGCCAAAAATAATGGCCT

[0054] GACCAATTATTCATCCGCGGGTCGATAAAAATTAAGTCGTTCAGGTAGTCAGTGCG

[0055] CTGGTAGCTGTTAAGCCAGGGGCGGTAGCGTCGCTGAAGCCGCTATCTGTAGAGC

[0056] ACACGGGACGATTGTGAAACGGCTGCTTTATCGCCTGACCTGAGGTAAGCATCCC

[0057] TATTAGATGCGTATCATAATCACTAGGTATCCTTCGAAGTTGGTCAGGATAGGCTGC

[0058] TGATATTGCCTGTGCAAAAACTTTCCCTACTCTTCCATAGCCTGGACGATAAAATT

[0059] CGCCTACATTGTGAGCTGGGCAGATGTTATGAGGGGTACAAGCAGCTAGGGTAA

[0060] ATGTACTTGCCTCGTCGGTGTTGCACACAGTGAAG...

example 2

[0099] (1) Wild strain: Klebsiella pneumoniae HR526

[0100] (2) Knockout of the main promoter of the capsular gene

[0101] ① Genomic DNA of Klebsiella pneumoniae HR526 was extracted and purified. Using it as a template, design primer 6:

[0102] GGGGTCTGGGTATTCGTG and primer 7: TGCCCTGGAGGTGGACAT, carry out PCR (polymerase chain reaction) amplification experiment, the target product CPS4 sequence includes double exchange knockout L arm, R arm and the full sequence CPS4 of the promoter to be replaced and knocked out. The results of CPS4 sequence sequencing are as follows:

[0103] GGGGTCTGGGTATTCGTGAGCTGGATTACACCGGCTTCAGCGGCCATTCCGCGC

[0104] TCTCCGCGGCCTTCTGGCCTATCTTCCTGTGGCTGCTCCAGCGCCCGTTTCTCCGTC

[0105] GGTCTGCGTAAAGCGGCCGTTATTACCGGCTATGTTCTGGCCGCCGTGGTGGGCT

[0106] ATTCGCGGCTGGTCATCCATGCGCATTCCGTCTCGGAGGTGATTGCCGGCCTGCT

[0107] GCTGGGCGCTGCTGGCAGCGCTTTGTTCCTGGTGTTGCAAAAACGTACCCCTGAT

[0108] CCGGAAAGCGTGAATATCTCATGGGGCGGTGTTGCATGCCTGGTGATGGTTCCG

[0109] CTTA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing Klebsiella without capsules, pertaining to the technical field of biochemical engineering. In PDO producing bacteria, a gene knockout method is adopted to knock out the promoter of the capsule protosome or integrate a terminator behind the promoter so as to stop the transcription of the capsule protosome, thus leading the capsules of the Klebsiella to be partially or completely deleted. Therefore, the fermentation liquor viscosity of the Klebsiella is reduced, the separation and extraction difficulty of POD products is reduced, simultaneously, the thalli pathogenicity is lowered, thereby being favorable to the PDO industrial production application of the Klebsiella.

Description

technical field [0001] The invention belongs to the field of biochemical technology, and in particular provides a method for constructing capsule-deleted Klebsiella. Background technique [0002] The capsule is a mucus-like substance that surrounds the cell wall of some bacteria. The capsules of most of these bacteria are composed of polysaccharides. The molecular composition and configuration of polysaccharides are diverse, making their structure extremely complex, which becomes the basis of serotyping. A small number of bacterial capsules are polypeptides, such as Bacillus anthracis and Yersinia pestis. [0003] The capsule has the following functions on bacteria: ① Anti-phagocytosis: Capsule can effectively resist the phagocytosis of host phagocytes because of its hydrophilicity, space occupation and barrier function. ② Adhesion: Capsular polysaccharides can make bacteria adhere to each other, and can also adhere to tissue cells or the surface of inanimate objects, whi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/09C12R1/22
Inventor 刘德华刘宏娟郭妮妮欧先金方建军罗吉安
Owner TSINGHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com