Polygonatum filipes microsatellite markers

A technology of microsatellite markers and Polygonatum, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem of poor repeatability, late start of molecular marker research, and inability to distinguish pure and genotypes from heterozygous genes Type and other issues

Inactive Publication Date: 2010-02-24
ANHUI NORMAL UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] The research on molecular markers of Polygonatum genus started very late, and only RAPD molecular markers and ISSR molecular markers are reported at present, but the stability and repeatability of RAPD molecular markers are poor, and ISSR molecular markers are usually dominant markers, which cannot distinguish between pure and genotypes and hybrids. Synthetic genotype, microsatellite markers are co-dominant markers, with more abundant polymorphisms, and the experimental results are stable and reproducible
However, the microsatellite markers of Rhizoma Polygonatum have not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polygonatum filipes microsatellite markers
  • Polygonatum filipes microsatellite markers
  • Polygonatum filipes microsatellite markers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] 1. Construction of Polygonatum long stem microsatellite DNA enrichment library

[0027] 1.1 Genome extraction and digestion:

[0028] Using the CTAB method introduced by Doyle J (Doyle J. DNA protocols for plants-CTAB totalDNA isolation [A]. In Hewitt GM, Johnston A (eds.), Molecular Techniques in Taxonomy [M]. Berlin: Springer, 1991, 283-293 ) to extract the genome, digest the genome with the restriction endonuclease Sau3AI (purchased from TaKaRa company), and electrophoresis the digested product on 1% agarose gel, cut out the DNA fragment of 300-900bp size under ultraviolet light and use the gel recovery kit (purchased from Shanghai Sangong) to purify and recover the digested product.

[0029] 1.2 Add connector:

[0030] Add the two ends of the purified and recovered enzyme-cut product to the adapter:

[0031] LA(5'-GGCCAGAGACCCCCAAGCTTCG-3')

[0032] LB(5'-PO 4 -GATCCGAAGCTTGGGGTCTCTGGCC-3'),

[0033] Under the action of T4 ligase (purchased from Promega), the ...

Embodiment 2

[0052] 2.1 Screen polymorphic primers:

[0053] Use the CTAB method of 1.1 to extract the Rhizoma Polygonatum genome. The genome was amplified with designed primers (Table 1). Reaction program: pre-denaturation at 94°C for 4 minutes, denaturation at 94°C for 45 seconds, annealing for 30 seconds (see Table 1 for annealing temperature), extension at 72°C for 35 seconds, and three steps from denaturation to annealing were repeated 35 times. A final full extension at 72°C for 8 minutes. 1.5% agarose gel electrophoresis detection. PCR products were detected by PAGE electrophoresis, and a total of 11 polymorphic microsatellite markers were obtained; Pt1 was 250 nucleotides, Pt2 was 370 nucleotides, Pt3 was 277 nucleotides, and Pt4 was 905 nuclei Pt5 is 729 nucleotides, Pt6 is 343 nucleotides, Pt7 is 247 nucleotides, Pt8 is 403 nucleotides, Pt9 is 297 nucleotides, Pt10 is 298 nucleotides , Pt11 is 319 nucleotides.

[0054] 2.2 Analysis of results:

[0055] The expected heterozy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses polygonatum filipes microsatellite markers. A method for realizing the technical scheme of the invention comprises the following steps: constructing an enriched library of a polygonatum filipes microsatellite (CT)n; screening and sequencing positive clones containing microsatellite sequences to obtain 84 clones containing microsatellite repetitive sequences; and screening the 84 clones to obtain the following 11 high-polymorphism microsatellite molecular markers: Pt1, Pt2, Pt3, Pt4, Pt5, Pt6, Pt7, Pt8, Pt9, Pt10 and Pt11. The 11 microsatellite markers can be used for researching the genetic diversity of polygonatum filipes and variable and evolutionary relationships among species and populations of polygonatum plants, have good repetitiveness and are reliable and effective molecular markers.

Description

technical field [0001] The invention relates to molecular marker technology, in particular to a microsatellite molecular genetic marker of Polygonatum long stem. Background technique [0002] Microsatellite DNA is also called short tandem repeats (Short Tandem Repeats, STRs), simple sequence repeats (Simple Sequence Repeat, SSRs), simple sequence length polymorphism (SSLP). Refers to the nucleotide sequence composed of 1 to 6 nucleotides in series in the genome. According to the composition of repeating units, microsatellite DNA sequences are divided into three types: single type, compound type (compound) and interrupted type (interrupted). For example: [0003] Single type: ATATATATATATATATATATATAT [0004] Composite type: ATATATCACACACACACACACAC [0005] Intermittent type: ATATATCA ATATATCA ATATATA [0006] As a molecular marker, microsatellite DNA has the following characteristics: it is widely distributed in the genome of eukaryotes; the number of repeats of the cor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor朱国萍刘婷婷程文娟彭艳秋王晖王宗达翟羽佳
OwnerANHUI NORMAL UNIV