Construction and application of farnesyl pyrophosphate synthase RNA interference recombinant lentiviral vector

A technology of farnesyl pyrophosphate and recombinant lentivirus, which is applied in the field of molecular biology and can solve the problem that non-viral vectors cannot satisfy long-term expression

Inactive Publication Date: 2011-11-30
ZHEJIANG UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] At present, the vectors for gene therapy mainly include non-viral vectors and viral vectors. However, non-viral vectors cannot satisfy long-term expression, and this defect is undoubtedly filled by viral vectors.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of farnesyl pyrophosphate synthase RNA interference recombinant lentiviral vector
  • Construction and application of farnesyl pyrophosphate synthase RNA interference recombinant lentiviral vector
  • Construction and application of farnesyl pyrophosphate synthase RNA interference recombinant lentiviral vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Example 1: FDS fusion gene plasmid and interference plasmid co-transfection tool cell screening FDS interference most effective target sequence siRNA:

[0073] 1. According to the design principle, 4 interference targets were designed according to the online RNAi series design software, and the double-stranded DNA was synthesized and connected to the linearized pGC-U6 / Neo / DsRed vector (purchased from Shanghai Jikai Gene Chemical Technology Co., Ltd., see figure 1 ) After the correct clone was identified, the plasmid was extracted for future use.

[0074] The target sequence (Target Seq) is as follows:

[0075] #1: GACAGCTTTCTACTTCTTTC

[0076] 2#: CACGCTAATGCCCTGAAGA

[0077] #3: CTGTAGGAGGCAAGTACAA

[0078] #4: CTGGTGGAACCAAGGAAAC

[0079] At the same time, the respective DNA synthesis fragment information is as follows:

[0080] 1#-1: 5'-GATCCCaaGACAGCTTTCTACTCTTTCTTCAAGAGAGAAAGAGTAGAAAGCTGTCttTTTTTGGAT-3'

[0081] 1#-2: 5'-AGCTATCCAAAAAaaGACAGCTTTCTACTCTTTCTCT...

Embodiment 2

[0094] Example 2: Construction and identification of lentiviral recombinant plasmid pGCSIL-sh-FDS

[0095] The most effective target sequence obtained by exogenous screening target is No. 1: GACAGCTTTCTACTCTTTC, the double-stranded DNA of its shRNA is synthesized, and the information of the synthesized fragment is as follows:

[0096] 1: CcggaaGACAGCTTTCTACTCTTTCTTCAAGAGAGAAAGAGTAGAAAAGCTGTCttTTTTTTg;

[0097] 2: aattcaaaaaaaGACAGCTTTCTACTCTTTTCTCTTGAAGAAAGAGTAGAAAGCTGTCtt.

[0098] Connected to the linear pGCSIL-GFP vector (purchased from Shanghai Jikai Gene Chemical Technology Co., Ltd., see image 3 ), ligation reaction system: 1 μl of carrier DNA (100ng / μl) recovered by enzyme digestion, 1 μl of annealed double-stranded DNA (100ng / μl), 1 μl of 10×T4 phage DNA ligase buffer, 1 μl of T4 phage DNA ligase, dd H2O 7μl, ligated at 4°C for 12h, then cultured at 37°C for 16h to transform into DH5 Escherichia coli, and positive clones were extracted and identified by PCR and sequ...

Embodiment 3

[0102] Embodiment 3: Preparation of FDS gene RNA interference recombinant lentiviral vector (LV-sh-FDS)

[0103] The lentiviral vector construction system (purchased from Shanghai Jikai Gene Chemical Technology Co., Ltd.) consists of the backbone plasmid vector pGCSIL-GFP, the helper plasmid pHelper1.0 carrying the virus gag, pol, and rev genes, and the helper plasmid pHelper containing VSV-G 2.0 composition.

[0104] Prepare recombinant virus plasmids encoding lentiviral particles and helper plasmids, namely pGCSIL-sh-FDS, pHelper1.0 and pHelper2.0 plasmids, and perform high-purity endotoxin-free extractions respectively. Aspirate the plasmid pGCSIL-sh-FDS (20 μg), pHelper 1.0 (15 μg) and pHelper 2.0 (10 μg), carry out co-transfection according to Invitrogen Company Lipofectamine 2000 instructions, successfully package FDS) gene RNA interference recombinant lentivirus (LV-sh -FDS), and set up a positive control at the same time, that is, pGCSIL-NS (negative reference) (20 μg),...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides the construction of a recombinant lentiviral vector targeting farnesyl pyrophosphate synthase RNA interference. The most effective target sequence of FDS gene RNAi is screened out in the tool cell 293T cells, and the double-stranded DNA of the most effective target sequence is synthesized and connected to pGCSIL - GFP vector, the recombinant vector was successfully constructed through restriction sequencing. Studies have shown that the constructed RNA interference vector LV-sh-FDS can down-regulate the expression of FDS mRNA level in neonatal rat cardiomyocytes, and can also down-regulate the expression of cardiac hypertrophy markers such as cell area and marker genes beta-MHC and BNP. While down-regulating FDS, it can also effectively inhibit the activity of RhoA, and can be used in the preparation of drugs for treating cardiac hypertrophy diseases. It can also be used in the preparation of drugs for regulating cholesterol metabolism.

Description

technical field [0001] The invention belongs to the technical fields of molecular biology, biomedicine and genetic engineering, and mainly relates to the construction of an RNA interference recombinant lentiviral vector (LV-sh-FDS) targeting the gene of Farnesyl pyrophosphate synthase (FDS) and its Applications in cardiac hypertrophy and regulation of cholesterol metabolism. Background technique [0002] Current research shows that small G protein is involved in the occurrence of cardiac hypertrophy. RhoA belongs to the superfamily of small G proteins, and has two forms: a GDP-bound inactive state and a GTP-bound active state. At present, many studies have shown that RhoA is involved in the occurrence of cardiac hypertrophy, such as angiotensin II (Ang II)-induced cardiac hypertrophy. Studies have found that overexpression of Rho-GDI (Rho-GDP separation inhibitor) and Rho inhibitor C3exeoezyme can significantly inhibit Ang II-induced cardiac hypertrophy. [0003] Farnesyl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/867C12N15/113A61K48/00A61P9/00A61P3/00
Inventor胡申江叶炀
OwnerZHEJIANG UNIV