Construction and application of farnesyl pyrophosphate synthase RNA interference recombinant lentiviral vector
A technology of farnesyl pyrophosphate and recombinant lentivirus, which is applied in the field of molecular biology and can solve the problem that non-viral vectors cannot satisfy long-term expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0072] Example 1: FDS fusion gene plasmid and interference plasmid co-transfection tool cell screening FDS interference most effective target sequence siRNA:
[0073] 1. According to the design principle, 4 interference targets were designed according to the online RNAi series design software, and the double-stranded DNA was synthesized and connected to the linearized pGC-U6 / Neo / DsRed vector (purchased from Shanghai Jikai Gene Chemical Technology Co., Ltd., see figure 1 ) After the correct clone was identified, the plasmid was extracted for future use.
[0074] The target sequence (Target Seq) is as follows:
[0075] #1: GACAGCTTTCTACTTCTTTC
[0076] 2#: CACGCTAATGCCCTGAAGA
[0077] #3: CTGTAGGAGGCAAGTACAA
[0078] #4: CTGGTGGAACCAAGGAAAC
[0079] At the same time, the respective DNA synthesis fragment information is as follows:
[0080] 1#-1: 5'-GATCCCaaGACAGCTTTCTACTCTTTCTTCAAGAGAGAAAGAGTAGAAAGCTGTCttTTTTTGGAT-3'
[0081] 1#-2: 5'-AGCTATCCAAAAAaaGACAGCTTTCTACTCTTTCTCT...
Embodiment 2
[0094] Example 2: Construction and identification of lentiviral recombinant plasmid pGCSIL-sh-FDS
[0095] The most effective target sequence obtained by exogenous screening target is No. 1: GACAGCTTTCTACTCTTTC, the double-stranded DNA of its shRNA is synthesized, and the information of the synthesized fragment is as follows:
[0096] 1: CcggaaGACAGCTTTCTACTCTTTCTTCAAGAGAGAAAGAGTAGAAAAGCTGTCttTTTTTTg;
[0097] 2: aattcaaaaaaaGACAGCTTTCTACTCTTTTCTCTTGAAGAAAGAGTAGAAAGCTGTCtt.
[0098] Connected to the linear pGCSIL-GFP vector (purchased from Shanghai Jikai Gene Chemical Technology Co., Ltd., see image 3 ), ligation reaction system: 1 μl of carrier DNA (100ng / μl) recovered by enzyme digestion, 1 μl of annealed double-stranded DNA (100ng / μl), 1 μl of 10×T4 phage DNA ligase buffer, 1 μl of T4 phage DNA ligase, dd H2O 7μl, ligated at 4°C for 12h, then cultured at 37°C for 16h to transform into DH5 Escherichia coli, and positive clones were extracted and identified by PCR and sequ...
Embodiment 3
[0102] Embodiment 3: Preparation of FDS gene RNA interference recombinant lentiviral vector (LV-sh-FDS)
[0103] The lentiviral vector construction system (purchased from Shanghai Jikai Gene Chemical Technology Co., Ltd.) consists of the backbone plasmid vector pGCSIL-GFP, the helper plasmid pHelper1.0 carrying the virus gag, pol, and rev genes, and the helper plasmid pHelper containing VSV-G 2.0 composition.
[0104] Prepare recombinant virus plasmids encoding lentiviral particles and helper plasmids, namely pGCSIL-sh-FDS, pHelper1.0 and pHelper2.0 plasmids, and perform high-purity endotoxin-free extractions respectively. Aspirate the plasmid pGCSIL-sh-FDS (20 μg), pHelper 1.0 (15 μg) and pHelper 2.0 (10 μg), carry out co-transfection according to Invitrogen Company Lipofectamine 2000 instructions, successfully package FDS) gene RNA interference recombinant lentivirus (LV-sh -FDS), and set up a positive control at the same time, that is, pGCSIL-NS (negative reference) (20 μg),...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 