Standard positive reference material for rana grylio virus (RGV) detection

A technology of iridescent virus and virus, which is applied in the field of standard positive reference materials, can solve the problems of poor sample purity, pathogen diffusion, and difficult precise quantification of virus genes, and achieve the effect of stable state and not easy to degrade

Inactive Publication Date: 2013-01-09
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] 2. The total DNA contains a large amount of host DNA, resulting in poor sample purity, difficult to accurately quantify viral genes, and prone to non-specific amplification
[0007] 3. If the whole virus is directly used as a control, there is still a risk of pathogen spread

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Standard positive reference material for rana grylio virus (RGV) detection
  • Standard positive reference material for rana grylio virus (RGV) detection
  • Standard positive reference material for rana grylio virus (RGV) detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Embodiment 1: the construction of standard positive reference substance of the present invention

[0020] 1. Specific primer design and target gene PCR amplification

[0021] Primers were designed and synthesized according to the complete gene sequence of turtle iridescent virus (STIV) nucleocapsid protein (MCP): SP1 (as shown in SEQ ID NO.1): 5'CGCATGTCTTCTGTAACTGG and SP2 (as shown in SEQ ID NO.2): 5' CGTTACAAGATTGGGAATCC. The primer sequence is newly designed by the inventor, and has the following characteristics: strong specificity, can specifically amplify the entire gene sequence of STIV MCP; moderate CG content, two structures that are not easy to form a hairpin ring because they have similar TM values, and meet the requirements of PCR ; The amplified sequence is suitable for ligation into the T vector.

[0022] The length of the target gene is 1397bp, and its sequence is shown in SEQ ID NO.3.

[0023] 20μl PCR system: STIV total DNA template 0.5ul, Buffer wit...

Embodiment 2

[0043] Using the standard positive reference material pGEM-T-S constructed in Example 1 as a template, different virus detection primers were used for PCR amplification. The sources of primers are shown in Table 1. The result is as figure 2 Shown, where M: molecular weight standard; -: negative control. Others are the amplification results of the corresponding viral MCP-specific primers. Such as figure 2 As shown in A, only STIV, as well as EHNV and TFV, which are both of the genus Rana iridovirus, have target genes, such as figure 2 As shown in B, other samples were negative. The results show that the standard positive reference substance pGEM-T-S of the present invention does not combine with non-rana iridovirus primers, has excellent specificity, and is suitable as a standard positive control in the PCR detection of STIV, EHNV and TFV.

[0044] Table 1: pGEM-T-S PCR specific detection primers

[0045]

Embodiment 3

[0047] Using the standard positive reference material pGEM-T-S constructed in Example 1 as a template, different virus detection primers and probes were used for fluorescent quantitative PCR detection. The sources of primers and probes are shown in Table 2. Primer and probe sequences, reaction conditions and reaction system were designed according to relevant references. The result is as image 3 As shown, where M: molecular weight standard; the signal curves are STIV primer probe, TFV primer probe and EHNV primer probe from top to bottom. The results show that the standard positive recombinant plasmid pGEM-T-S of the present invention can combine with the MCP-specific primer probes of STIV, EHNV and TFV, and emit fluorescent signals, so it is suitable as a standard positive control in the fluorescent quantitative PCR detection of these three viruses.

[0048] Table 2: Specific detection primers for pGEM-T-S fluorescent quantitative PCR

[0049]

[0050]

[0051] It ca...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a standard positive reference material for rana grylio virus (RGV) detection. In the invention, a pair of primers are firstly designed, which can specifically amplify capsid protein complete genes of soft-shelled turtle iridovirus nuclears, wherein the nucleotide sequences of the primers are shown in SEQ ID.1 and SEQ ID NO.2; the capsid protein complete genes of the soft-shelled turtle iridovirus nuclears amplified by the primers have the nucleotide sequence shown in SEQ ID NO.3; and a recombinant plasmid pGEM-T-S containing the capsid protein complete genes of the soft-shelled turtle iridovirus nuclears is constructed and screened after a proper PCR reaction system and reaction conditions are found out, which can be used as the standard positive reference material for molecular biology detection on STIV MCP, EHNV MCP and TFV MCP.

Description

technical field [0001] The invention relates to the technical field of molecular biology detection, in particular to a standard positive reference material for detecting frog iridescent virus. Background technique [0002] Soft-shelled turtle iridovirus (STIV) is an iridovirus that infects reptile aquatic products such as soft-shelled turtles, and its mortality rate exceeds 40% (Chen et al., 1999, Virus Res. 63, 147-151). Current molecular biology detection methods (PCR, fluorescent quantitative PCR, etc.) for soft-shelled turtle iridescent virus mainly use primers or probes designed according to a certain conserved sequence in the virus nucleocapsid protein (major capsid protein, MCP) gene, and positive The nucleic acid sample and the detection sample are respectively subjected to specific amplification under the same reaction system and reaction conditions. After the reaction is completed, the target gene or special signal curve of the positive nucleic acid sample is compa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/11C12N15/34C12N15/63C12Q1/70C12Q1/68
Inventor张旻江育林
OwnerCHINESE ACAD OF INSPECTION & QUARANTINE