Standard positive reference material for rana grylio virus (RGV) detection
An iridescent virus and specific technology, applied in the field of standard positive reference materials, can solve the problems of poor sample purity, spread of pathogens, and difficult to accurately quantify viral genes, and achieve the effect of stable state and non-degradation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Embodiment 1: the construction of standard positive reference substance of the present invention
[0020] 1. Specific primer design and target gene PCR amplification
[0021] Primers were designed and synthesized according to the complete gene sequence of turtle iridescent virus (STIV) nucleocapsid protein (MCP): SP1 (as shown in SEQ ID NO.1): 5'CGCATGTCTTCTGTAACTGG and SP2 (as shown in SEQ ID NO.2): 5' CGTTACAAGATTGGGAATCC. The primer sequence is newly designed by the inventor, and has the following characteristics: strong specificity, can specifically amplify the entire gene sequence of STIV MCP; moderate CG content, two structures that are not easy to form a hairpin ring because they have similar TM values, and meet the requirements of PCR ; The amplified sequence is suitable for ligation into the T vector.
[0022] The length of the target gene is 1397bp, and its sequence is shown in SEQ ID NO.3.
[0023] 20μl PCR system: STIV total DNA template 0.5ul, Buffer wit...
Embodiment 2
[0043] Using the standard positive reference material pGEM-T-S constructed in Example 1 as a template, different virus detection primers were used for PCR amplification. The sources of primers are shown in Table 1. The result is as figure 2 Shown, where M: molecular weight standard; -: negative control. Others are the amplification results of the corresponding viral MCP-specific primers. Such as figure 2 As shown in A, only STIV, as well as EHNV and TFV, which are both of the genus Rana iridovirus, have target genes, such as figure 2 As shown in B, other samples were negative. The results show that the standard positive reference substance pGEM-T-S of the present invention does not combine with non-rana iridovirus primers, has excellent specificity, and is suitable as a standard positive control in the PCR detection of STIV, EHNV and TFV.
[0044] Table 1: pGEM-T-S PCR specific detection primers
[0045]
Embodiment 3
[0047] Using the standard positive reference material pGEM-T-S constructed in Example 1 as a template, different virus detection primers and probes were used for fluorescent quantitative PCR detection. The sources of primers and probes are shown in Table 2. Primer and probe sequences, reaction conditions and reaction system were designed according to relevant references. The result is as image 3 As shown, where M: molecular weight standard; the signal curves are STIV primer probe, TFV primer probe and EHNV primer probe from top to bottom. The results show that the standard positive recombinant plasmid pGEM-T-S of the present invention can combine with the MCP-specific primer probes of STIV, EHNV and TFV, and emit fluorescent signals, so it is suitable as a standard positive control in the fluorescent quantitative PCR detection of these three viruses.
[0048] Table 2: Specific detection primers for pGEM-T-S fluorescent quantitative PCR
[0049]
[0050]
[0051] It ca...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com