Preparation method and application for dual-fluorescence reporting system with micro-RNA (ribonucleic acid) function

A reporting system and dual fluorescence technology, applied in biochemical equipment and methods, fluorescence/phosphorescence, recombinant DNA technology, etc., can solve problems such as difficulty in ensuring equal or proportional expression, poor experimental repeatability, and inability to detect miRNA

Inactive Publication Date: 2012-05-09
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, the simultaneous transfection of two plasmids is difficult to ensure the equal or proportional expression of the target mRNA and its target genes, and the experimental repeatability is not good
More importantly, existing reporter systems such as the luciferase system need to break or fix cells when detecting signals, and cannot detect the function of miRNA in living cells, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application for dual-fluorescence reporting system with micro-RNA (ribonucleic acid) function
  • Preparation method and application for dual-fluorescence reporting system with micro-RNA (ribonucleic acid) function
  • Preparation method and application for dual-fluorescence reporting system with micro-RNA (ribonucleic acid) function

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] A kind of preparation method of the dual fluorescent reporter system of microRNA function, its steps are:

[0045] (1) The mCherry gene sequence was obtained by PCR amplification from the plasmid pRSET-B-mCherry (gifted by Dr.Roger Y.Tsien), and the mCherry gene was inserted into the pEGFP-C1 vector by using the double restriction sites Nhe I and Bgl II (purchased from Clontech), replace the EGFP sequence on pEGFP-C1, and construct the vector pmCherry-C1;

[0046] (2) Using the RNAi-Ready pSIREN-RetroQ plasmid (purchased from Clontech) as a template, the U6 promoter fragment was obtained by PCR amplification. The upstream primer used in PCR: 5'-CAACATACGCGTTCGGGCAGGAAGAGGGCCTATTTCC-3' (Mlu I), the downstream primer: 5'-ATGGATACGCGTGCGGCCGCGACTGATATCCCGGTGTTTCGTCCTTTCACAAGAT-3' (Mlu I). The PCR amplification conditions were: 94°C for 5min, one cycle; 94°C for 45s, 60°C for 50s, 72°C for 30s, 30 cycles; finally, 72°C for 5min. The amplified product was subjected to 1% (...

Embodiment 2

[0049] A kind of application of double fluorescence reporter plasmid pMGhU6 in the inhibition function detection of microRNA, its steps are:

[0050] (1) Utilize the known human microRNA miR30 and its target sequence (Zeng et al., 2002, Mol.Cell.9: 1327-1333) ( figure 2 ) to verify the newly constructed dual fluorescent reporter system and detect its function for microRNAs to inhibit their targets.

[0051] (2) The expression sequence of microRNA miR30 (forward sequence mir30-sense: CTCGTGATCTGCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCCACAGATGGGCTTTCAGT reverse sequence mir30-anti: ATGTTATCCGCGGCCGCAAAAACTCGTGGATCCGCAGCTGCAAACATCCGACTGAAAGCCCATC, including Not I site) was synthesized by Shanghai Sangong. The primers mir30-sense and mir30-anti were mixed, denatured, annealed, and used as templates for PCR extension. The PCR product recovery kit (from Omega) recovered the product to obtain the pre-miR30 sequence. The PCR amplification conditions were: 94°C for 1.5min, one cycle; 94°C ...

Embodiment 3

[0055] The application of a kind of dual fluorescent reporter plasmid pMGhU6 in the live cell imaging detection of the suppressive function of microRNA, its steps are:

[0056] (1) The plasmid pMGhU6 was transfected into Hela cells, and after 48 hours, the cells were observed with a laser confocal microscope. Green fluorescent protein and red fluorescent protein were co-expressed in the same cell, and the distribution of the two kinds of fluorescence showed a whole-cell distribution. The fluorescence results showed that the expression of mCherry on the plasmid pMGhU6 was correct and the connection into the independent EGFP expression cassette worked, which further indicated that the construction of the pMGhU6 plasmid had achieved the expected effect.

[0057] (2) The plasmid pmiR30-4tar was transfected into Hela cells, and after 48 hours, fluorescence observation was carried out using a laser confocal microscope, and pictures were taken. Acquisition of all fluorescence images...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method and an application for a dual-fluorescence reporting system for detecting a micro-RNA (ribonucleic acid) function, wherein the preparation method comprises the following preparation steps of: A, obtaining a mCherry gene sequence via a PCR (polymerase chain reaction) amplification, inserting a rho EGFP-C1 carrier to replace the EGFP (enhanced green fluorescent protein) sequence of the mCherry gene sequence, and constructing a carrier rho mCherry-C1; B, using a RNAi-Ready rho SIREN-RetroQ plasmid as a template, obtaining a human U6 promoter gene via a PCR amplification, and inserting the carrier rho mCherry-C1 to obtain a plasmid rho hU6-mCherry-C1; and C, obtaining a gene sequence carried with a CMV (cytomegalovirus) promoter and an EGFP expression dialog sequence in an interval of 358 to 1944 on a plasmid rho Adtrack-CMV, and inserting the sequence in the plasmid rho hU6-mCherry-C1 to obtain a plasmid rho MGhU6. The plasmid rho MGhU6 is a dual-fluorescence reporting system simultaneously containing a mCherry reporting gene, an internal reference EGFP, a micro-RNA and the target sequence insertion site thereof. The reporting system can be used for detecting the inhibition function of the micro-RNA to the target sequence expression. The detection method is easy, as well as simple and convenient in operation; and a function detection for the micro-RNA can be realized by transfecting one plasmid only. The system also can be used for visually detecting the inhibition function of a micro-RNA in a single living cell to the target thereof by the aid of fluorescence microscopic imaging.

Description

technical field [0001] The invention relates to the technical field of microRNA function detection, more specifically to a preparation method of a dual fluorescent reporter system for detecting microRNA function, and also relates to the application of a dual fluorescent reporter system for microRNA function. In the same vector, different eukaryotic promoters can be used to transcribe both microRNA and red fluorescent protein mCherry gene, and the target sequence of microRNA can be connected to the 3'-UTR region of mCherry gene to control the expression of mCherry ; At the same time, the vector can independently express the green fluorescent protein EGFP as an internal reference. In the experiment, by measuring the fluorescence intensity ratio of the green fluorescent protein EGFP and the red fluorescent protein mCherry, compared with the control group, the inhibitory function of the microRNA can be evaluated. The new system is a simple, effective, convenient and reliable plas...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/66C12N15/65C12Q1/68G01N21/64
Inventor崔宗强尤祥宇张先恩张治平
OwnerWUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI