Preparation method and application for dual-fluorescence reporting system with micro-RNA (ribonucleic acid) function
A dual fluorescence, reporter plasmid technology, applied in the direction of fluorescence/phosphorescence, recombinant DNA technology, the use of vectors to introduce foreign genetic material, etc., can solve broken or fixed cells, it is difficult to ensure equal or proportional expression, and the experiment repeatability is not good And other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] A kind of preparation method of the dual fluorescent reporter system of microRNA function, its steps are:
[0045] (1) The mCherry gene sequence was obtained by PCR amplification from the plasmid pRSET-B-mCherry (gifted by Dr.Roger Y.Tsien), and the mCherry gene was inserted into the pEGFP-C1 vector by using the double restriction sites Nhe I and Bgl II (purchased from Clontech), replace the EGFP sequence on pEGFP-C1, and construct the vector pmCherry-C1;
[0046] (2) Using the RNAi-Ready pSIREN-RetroQ plasmid (purchased from Clontech) as a template, the U6 promoter fragment was obtained by PCR amplification. The upstream primer used in PCR: 5'-CAACATACGCGTTCGGGCAGGAAGAGGGCCTATTTCC-3' (Mlu I), the downstream primer: 5'-ATGGATACGCGTGCGGCCGCGACTGATATCCCGGTGTTTCGTCCTTTCACAAGAT-3' (Mlu I). The PCR amplification conditions were: 94°C for 5min, one cycle; 94°C for 45s, 60°C for 50s, 72°C for 30s, 30 cycles; finally, 72°C for 5min. The amplified product was subjected to 1% (...
Embodiment 2
[0049] A kind of application of double fluorescence reporter plasmid pMGhU6 in the inhibition function detection of microRNA, its steps are:
[0050] (1) Utilize the known human microRNA miR30 and its target sequence (Zeng et al., 2002, Mol.Cell.9: 1327-1333) ( figure 2 ) to verify the newly constructed dual fluorescent reporter system and detect its function for microRNAs to inhibit their targets.
[0051] (2) The expression sequence of microRNA miR30 (forward sequence mir30-sense: CTCGTGATCTGCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCCACAGATGGGCTTTCAGT reverse sequence mir30-anti: ATGTTATCCGCGGCCGCAAAAACTCGTGGATCCGCAGCTGCAAACATCCGACTGAAAGCCCATC, including Not I site) was synthesized by Shanghai Sangong. The primers mir30-sense and mir30-anti were mixed, denatured, annealed, and used as templates for PCR extension. The PCR product recovery kit (from Omega) recovered the product to obtain the pre-miR30 sequence. The PCR amplification conditions were: 94°C for 1.5min, one cycle; 94°C ...
Embodiment 3
[0055] The application of a kind of dual fluorescent reporter plasmid pMGhU6 in the live cell imaging detection of the suppressive function of microRNA, its steps are:
[0056] (1) The plasmid pMGhU6 was transfected into Hela cells, and after 48 hours, the cells were observed with a laser confocal microscope. Green fluorescent protein and red fluorescent protein were co-expressed in the same cell, and the distribution of the two kinds of fluorescence showed a whole-cell distribution. The fluorescence results showed that the expression of mCherry on the plasmid pMGhU6 was correct and the connection into the independent EGFP expression cassette worked, which further indicated that the construction of the pMGhU6 plasmid had achieved the expected effect.
[0057] (2) The plasmid pmiR30-4tar was transfected into Hela cells, and after 48 hours, fluorescence observation was carried out using a laser confocal microscope, and pictures were taken. Acquisition of all fluorescence images...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com