Unlock instant, AI-driven research and patent intelligence for your innovation.

Pollen-specific promoter and expression vector and application thereof

An expression vector and pollen-specific technology, which is applied in the fields of molecular biology and genetic engineering, can solve the problems of patents of wheat pollen-specific promoters, etc., and achieve the effect of broad agricultural economic value and broad application prospects

Inactive Publication Date: 2012-07-04
HUAZHONG UNIV OF SCI & TECH
View PDF5 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there are many pollen-specific promoters that have been isolated, but they are mainly concentrated in model plants. There are also some patents related to this aspect in my country, such as the pollen-specific promoter of carnation CMB2 (authorized announcement number ZL 200710025135.3), Arabidopsis AtA7 Anther-specific promoters (authorized announcement number ZL 200710177905.6), maize Zm401 anther villous layer and pollen-specific promoters (authorized announcement number ZL 200910080351.7), etc., but no patents for wheat pollen-specific promoters

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pollen-specific promoter and expression vector and application thereof
  • Pollen-specific promoter and expression vector and application thereof
  • Pollen-specific promoter and expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1. Cloning of the pollen-specific promoter PSG076

[0035] The present invention has obtained the PSG076 promoter sequence by reverse PCR technology, and the technical flow chart is as follows figure 1 shown. Extract wheat genomic DNA, select restriction endonucleases AatII, BamHI, and SacI to digest the genomic DNA, recover the digested fragments and perform circularization under the catalysis of DNA ligase, and use the circularized products as templates for PCR amplification. increase.

[0036] Two pairs of nested primers (primer 1 and primer 2, primer 3 and primer 4) were designed and synthesized to isolate the promoter of PSG076.

[0037] Primer 1: 5'GAGCATGGCGTTGGGACTCC 3'

[0038] Primer 2: 5'GCTAGGCCGATGGATGACC 3'

[0039] Primer 3: 5'TGCAGGGCAAGGAGGGTAGC 3'

[0040] Primer 4: 5'GATCGTCGGGATGGGTGATAG 3'

[0041] PCR reaction program: pre-denaturation at 94°C for 5 minutes, followed by 35 cycles at 94°C for 30 sec, 60°C for 30 sec, and 72°C for 2 min. ...

Embodiment 2

[0042] Example 2. Isolation of the sequence of the pollen-specific promoter PSG076

[0043] Primer 5 and primer 6 were designed and synthesized to isolate the PSG076 promoter sequence. For the convenience of later isolation and vector construction, a restriction endonuclease HindIII site and a BamHI site were added to the 5' end of the primers (the underline indicates the enzyme cutting site point):

[0044] Primer 5: 5' AAGCTT CGGGAAATCATTAATTGTTGAAGA 3’

[0045] Primer 6: 5' GGATCC AAGAACGGAGGCGAATG 3'

Embodiment 3

[0047] Example 3. Construction of p14G expression vector containing PSG076 promoter

[0048] The pBI121 plasmid was extracted with a plasmid extraction kit (Tiangen Biochemical Technology Co., Ltd.), and the 35S-GUS-nos expression cassette was obtained after restriction enzyme digestion with HindIII and EcoRI, and connected to the corresponding restriction site of the pMD18-T vector (TaKaRa Co., Ltd.) On the point, the constructed vector was named p35G, transformed into DH5a, and positive clones were screened by PCR reaction. The PCR reaction procedure was the same as in Example 1, except that the time at 72° C. was changed to 1 min, and the primers were primers 7 and 8 for detecting the GUS gene.

[0049] Primer 7: 5'AGTGTACGTATCACCGTTTGTGTGAAC 3'

[0050] Primer 8: 5'ATCGCCGCTTTGGACATACCATCCGTA 3'

[0051] The expression vector p14 in Example 2 was extracted with a plasmid extraction kit, and the PSG079 promoter digested by HindIII and BamHI was connected to the correspond...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pollen-specific promoter and an expression vector thereof. Experiments show that the promoter can drive efficient and specific expression of a target gene in the pollen of transgenic rice. The promoter of the invention can be used for functional analysis and identification of genes related to growth and development of plant pollen, as well as creation of plant male sterile lines, prevention of plant transgenic drift, and the like. Especially, the promoter has an important application value in creation of male sterile lines of rice and other gramineous crops and utilization of heterozygous advantages.

Description

technical field [0001] The present invention relates to a pollen-specific promoter and expression vector, in particular to the expression vector constructed with the promoter to obtain transgenic wheat plants through biolistic transformation. Transgenic analysis shows that the promoter can drive the target gene in pollen with high efficiency and specificity Expression belongs to the fields of molecular biology and genetic engineering. Background technique [0002] Pollen is the male gametophyte of plants, and its development involves the entire process from sporophyte cell development to pollen maturation. This process is very complicated and requires the coordinated expression of a large number of genes under the precise regulation of different promoters. play an important role in the normal developmental regulation of Most of the currently known pollen-specific promoters come from model plants, such as Arabidopsis, tobacco, rice, etc. Wheat is an important food crop, and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/63C12N1/21C12N15/82A01H5/00C12R1/19
Inventor 何光源陈泠高春保杨广笑李克秀苏佩佩汪成曾坚
Owner HUAZHONG UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More