Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Applications of miR-455-3p in diagnosis, treatment and prognosis of esophageal squamous cancer

A technology for squamous cell carcinoma of the esophagus, applied in gene therapy, medical preparations containing active ingredients, biochemical equipment and methods, etc., can solve problems such as difficult to kill tumor stem cells

Active Publication Date: 2015-07-15
SUN YAT SEN UNIV CANCER CENT
View PDF9 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional drugs are difficult to kill cancer stem cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of miR-455-3p in diagnosis, treatment and prognosis of esophageal squamous cancer
  • Applications of miR-455-3p in diagnosis, treatment and prognosis of esophageal squamous cancer
  • Applications of miR-455-3p in diagnosis, treatment and prognosis of esophageal squamous cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 miR-455-3p is upregulated in ESCC samples

[0041] (1) TCGA database analysis

[0042] Methods: Using SPSS statistical analysis method, the expression level of miR-455-3p and its relationship with survival rate were analyzed in 186 ESCC patients and 13 ESCC paracancerous tissues in The Cancer Genome Altas Project (TCGA). All statistical analyzes were processed with SPSS17.0 statistical software. Values ​​are expressed as mean ± SD, P <0.05 was considered a statistically significant difference.

[0043] The analysis results showed that the expression of miR-455-3p in ESCC tumor tissue was significantly higher than that in paracancerous tissue samples ( P figure 1 -A); define the expression of miR-455-3p in ESCC tumor tissue exceeding the median expression, called miR-455-3p high expression; ESCC tumor tissue miR-455-3p expression lower than the median expression, called miR-455-3p low expression, from figure 1 In -B, it can be seen that the high expr...

Embodiment 2

[0053] Example 2 Construction of ESCC tumor cell lines resistant and sensitive to chemotherapeutic drugs

[0054] (1) Establishment of drug-resistant strains and non-drug-resistant strains

[0055] Methods: The tumor cells of ESCC patients were subcutaneously inoculated into NOD / SCID mice (4–5 weeks old, 18-20g), and one week later, the mice were intraperitoneally injected with PBS buffer or 5mg / kg cis-diamine Chloroplatinum (CDDP), twice a week for 4 weeks. Afterwards, the ESCC tumor cells in the mice were isolated and cultured on a plate, and the above steps were repeated 3 times. The mouse tumor cells after the fourth inoculation were isolated and cultured on a plate. The ESCC tumor cells obtained in the CDDP group were CDDP-treated ESCC strains (hereinafter referred to as EC-CR), and those in the PBS group were non-CDDP-treated ESCC strains (hereinafter referred to as EC-CR). EC-NT) (see 2-A). EC-CR and EC-NT cells were treated with chemotherapeutic drugs cis-diammi...

Embodiment 3

[0074] Example 3 Construction of miR-455-3p stable high expression and inhibited expression cells

[0075] (1) microRNA associated with ESCC tumor stem cells

[0076] Using microRNA expression profile analysis to detect the expression of microRNA in EC-CR and EC-NT cells, it was found that miR-455-3p was highly expressed in EC-CR and EC-NT cells, and the expression of miR-455-3p in EC-CR The expression level is higher than that of EC-NT (see image 3 -A).

[0077] (2) Construction of stable cells with high expression of miR-455-3p

[0078] ESCC cells EC-NT were cultured in DMEM medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (Gibco) in a carbon dioxide incubator at 37°C.

[0079] 1) Construct the overexpression plasmid of miR-455-3p

[0080] The full-length mRNA sequence of miR-455-3p, UCCCUGGCGUGAGGGUAUGUGCCUUUGGACUACAUCGUGGAAGCCAGCACCAUGCAGUCCAUGGGCAUAUACACUUGCCUCAAGGCCUAUGUCAUC (SEQ ID NO: 5), was amplified by PCR.

[0081] The primer sequences are ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses applications of miR-455-3p in the diagnosis, treatment, and prognosis of esophageal squamous cancer. The inventor finds that the obviously low survival rate of ESCC patients is related with the high expression of miR-455-3p in ESCC patients. The in-vitro and in-vivo experiment results show that miR-455-3p is capable of promoting the malignant progression of ESCC, by inhibiting the expression of miR-455-3p, the ESCC stem cell characteristics can be inhibited, and the sensitivity of ESCC stem cells to chemotherapy drugs is enhanced; so an expression inhibitor of miR-455-3p can inhibit the tumor stem cells, and is capable of inhibiting the tumor stem cell characteristics and enhancing the sensitivity of the cancer stem cells to chemotherapy drugs. The invention finds the expression of miR-455-3p in cancer patients for the first time, and the expression can be used as auxiliary diagnosis and / or prognosis of ESCC. The invention provides a novel diagnosis method, a novel treatment method, and a pharmaceutical drug screening platform for tumor diseases.

Description

Technical field [0001] The invention is a biotechnology field, which involves a new application of Microrna and its Antagomir, which specializes in the application of MIR-455-3P and Antagomir-455-3P. Background technique [0002] ESOPHAGEAL SQUAMOUS CARCINOMA (ESCC) is one of the most common malignant tumors in the world, with its mortality rate sixth.About 90%of my country's esophageal cancer is squamous cell carcinoma, and it has significant regionality. The incidence of esophageal squamous cell carcinoma in high incidence areas is 500 times that of low incidence areas.Factors such as the history of tobacco and alcohol, the lack of nutrition, the hot food, and the intake of carcinogen are all related to esophageal squamous cell carcinoma.Surgery and chemotherapy are important treatment methods for esophageal squamous cell carcinoma, but their 5 -year survival rate is only about 10%.Drug resistance is difficult to overcome the treatment of esophageal squamous cell carcinoma.Trad...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68A61K48/00A61K31/7088A61P35/00
CPCA61K31/7088C12Q1/6886C12Q2600/118C12Q2600/158C12Q2600/178
Inventor 宋立兵李隽刘爱斌曹丽雪朱金容吴阁艳吴淑
Owner SUN YAT SEN UNIV CANCER CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com