Insect site-directed gene knock-in composition and method and application thereof

A technology of gene knock-in and composition, applied in the field of genetics transgenic technology and biological biology, can solve the problems of no practical value and cumbersome operation of other insect species

Active Publication Date: 2020-08-04
FUZHOU UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In Drosophila melanogaster, if a special tool transgenic Drosophila strain is prepared in advance, and then site-directed transgene integration reaction is carried out in the tool Drosophila strain, the efficiency can only reach 0-10%; Drosophila strain, not only the operation itself is cumbersome, but also has no practical value for other insect species

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Insect site-directed gene knock-in composition and method and application thereof
  • Insect site-directed gene knock-in composition and method and application thereof
  • Insect site-directed gene knock-in composition and method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0219] 2.5 Preparation of the recombinant factor of the present invention

[0220] The reading frame sequence of the recombination factor of the present invention is cloned from the genome of the DH5alpha strain, and the codon optimization is performed after sequencing verification. Each Rec sequence was added to the nuclear sequence (nucleus localization sequence), and then the SP6 promoter sequence was added upstream of the entire sequence, and capped and polyA-added mRNA was obtained using an in vitro transcription kit, and mixed in different combinations- Freeze at 80°C for later use.

[0221] 2.6 Preparation of transgenic insect strains

[0222] Transgenic manipulations of medflies were performed according to standard methods. Inject yw genotype Drosophila, using black body yellow, red eye miniwhite or fluorescent eye 3xP3-Red as screening markers.

[0223] 2.7 Determining the KI efficiency of site-specific knock-in integration

[0224] The F0 generation of fruit flie...

Embodiment 1

[0226] Example 1. Mapping potential nicks at target sites of interest for Drosophila Hh integration

[0227] Previous studies used the Mino transposon-mediated integration cassette (Minos Mediated Integration Cassette, MIMIC) to generate a large number of random insertions on the Drosophila genome. There are gene integration sites on the MiMIC element, and researchers can select a suitable MiMIC insertion near the gene of interest to replace and introduce exogenous DNA fragments. However, this method cannot integrate foreign DNA fragments at designated positions of genes. In this example, the inventors took the Hh gene as the research object, and introduced an integration cassette (structure: attB1-yellow-attB2) into the second intron of the Hh gene, and the full length of the integration element was 10.2 kb.

[0228] The goal of Drosophila Hh genetic modification is to construct transgenic Drosophila strains, insert attB sites into endogenous Hh gene loci, and carry phenotyp...

Embodiment 2

[0235] Example 2. Design of Exogenous Donor DNA Templates

[0236] Such as Figure 5 The donor DNA template was designed as shown, with 1 kb of homologous sequence upstream of the upstream nick (upstream homology arm) and 1 kb of homologous sequence downstream of the downstream nick (downstream homology arm). The attB-yellow-attB coding sequence was added at the integration site. This element comprising upstream and downstream homology arms and attB-yellow-attB is molecularly cloned into the pBluescript II vector (Agilent's plasmid vector), and the plasmid is amplified and extracted to become an exogenous donor DNA (see SEQ ID for the nucleotide sequence NO:13).

[0237] TGCTGCTGCCATGGAATTCCAAAGAAAATGCACCTTCCCAGTGGCCAGCCCGAAATTCCCATTGATGCATTTTGGTAAACAGAGACAGGCGGACACACAAAAGTGTAGAAACAATAAAAATCGGATTAAATACATATGGCTGGCGGTCTATAAAACCCATAATCGATGTGGATGGACGAAAGGGGAATGGGATCGGAAAGAGAATAGGAATCGGAATCGAAATCGGGCCCAAAAGAACACACGAAATGGACAAAAGATTCTGGGGAGATGGAGAGAAGGAAGCGCGGTAGTAACAAGAAAAATTGGTGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a composition used in insect targeted gene knock-in, which includes a single nickase or an encoding polynucleotide thereof; a recombinant factor or an encoding polynucleotide thereof; and optionally, a donor DNA of an exogenous gene. The invention also provides a corresponding gene knock-in method and a method for preparing transgenic insects. The composition and the method in the invention can achieve high-effective homologous recombination integration in insect cells and meanwhile can avoid the defects in gene knock-in technologies in the prior art. The composition also can stably and high-effectively achieve homologous recombination integration of a fragment being more than 10 kb in length in the insect cells, so that the composition can be used for transferring a genetic selection marker into the insect cells, preferably a visible genetic selection marker, which is convenient to determine strains of transgenic insects.

Description

technical field [0001] The invention relates to the fields of genetic transgene technology and biological biotechnology. Specifically, the present invention relates to a site-directed gene knock-in composition for efficiently and precisely introducing exogenous DNA fragments with visible screening markers into insect genomes, and its use and application. Background technique [0002] With the continuous development and improvement of whole genome sequencing technology and the implementation of large-scale genome annotation projects, biological science research has entered the post-genome era. The focus of research has also shifted to gene function, that is, from determining the DNA sequence of genes and explaining all the genetic information of life to the study of biological functions at the molecular level, exploring the mysteries of human health and diseases at the molecular level (Peltonen and McKusick ,2001). However, it is a great challenge to convert massive and bor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/245C12N15/31C12N5/10A01K67/033
Inventor杨宇丰张西张敏杰陈文锋孙玲李江
OwnerFUZHOU UNIV