Supercharge Your Innovation With Domain-Expert AI Agents!

Sheep myostatin gene dondor carrier construction method and its application

A sheep and carrier technology, applied in the field of molecular biology, can solve problems such as low efficiency, and achieve the effect of improving efficiency and strong pertinence

Inactive Publication Date: 2013-08-28
INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The emergence of homologous recombination technology has laid the foundation for gene mutation, however, usually this efficiency is very low, and the homologous arm is long as long as the homologous sequence of thousands of bases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sheep myostatin gene dondor carrier construction method and its application
  • Sheep myostatin gene dondor carrier construction method and its application
  • Sheep myostatin gene dondor carrier construction method and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Using sheep genomic DNA as a template, add the upstream primer of the left arm of the ApaI restriction site: gggcccgtgacacggcagaggttttaat, and add the downstream primer of the BamHI restriction site: ggatccagatccccaaacactctcctac; the homolog containing the ApaI and BamHI restriction sites was amplified by PCR. The source left arm sequence is SEQ ID NO.1; the upstream primer with the KpnI restriction site added to the right arm is: ggtaccaggtaacagacacaccaaaaag, and the downstream primer with the ApaI restriction site is: gggcccctactaccatgcctggaatctt, which can amplify with KpnI and ApaI restriction sites The homologous right arm of SEQ ID NO.2. The homologous left arm sequence containing ApaI and BamHI restriction sites and the backbone vector pEGFP-C1 (commercialized vector, available for purchase) containing the same restriction site (sequence is SEQ ID NO.7) were respectively subjected to BamHI single enzyme After being recovered from the gel, ligated with T4 ligase, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a sheep myostatin gene dondor carrier construction method and its application. The sheep myostatin gene dondor carrier is provided with strong pertinency, and is mainly used for combination at the double-stranded DNA fracture at the combination of a third exon and a second intron, which improves homologous recombination efficiency, helps the third exon of the sheep myostatin gene abrupt change, and obtains the removal of the sheep myostatin gene.

Description

technical field [0001] The invention belongs to the field of molecular biology, and in particular relates to a construction method of a sheep myostatin gene donor carrier and an application thereof. Background technique [0002] The existing literature shows that the mutation of the third exon base of sheep myostatin gene can cause the mutation of myostatin protein, and then produce individuals with double-muscle phenotype. The full length of sheep myostatin gene is 10529bp, which contains 3 introns and 3 exons. Myostatin (MSTN), also known as GDF-8 (growth differentiation factor-8), belongs to the β-transforming growth factor (transforming growth factor beta, TGF-β) superfamily. Studies on mouse embryos at different stages have shown that the expression of GDF-8mRNA appears to inhibit muscle development. Early on, GDF-8 expression restricts somite development, and gene-targeted disruption of the MSTN gene causes massive and widespread increases in skeletal muscle mass, le...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/66C12N15/63C12N15/09
Inventor 李万利李文清王二耀徐照学曹文广
Owner INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More