Sheep myostatin gene dondor carrier construction method and its application
A sheep and carrier technology, applied in the field of molecular biology, can solve problems such as low efficiency, and achieve the effect of improving efficiency and strong pertinence
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Using sheep genomic DNA as a template, add the upstream primer of the left arm of the ApaI restriction site: gggcccgtgacacggcagaggttttaat, and add the downstream primer of the BamHI restriction site: ggatccagatccccaaacactctcctac; the homolog containing the ApaI and BamHI restriction sites was amplified by PCR. The source left arm sequence is SEQ ID NO.1; the upstream primer with the KpnI restriction site added to the right arm is: ggtaccaggtaacagacacaccaaaaag, and the downstream primer with the ApaI restriction site is: gggcccctactaccatgcctggaatctt, which can amplify with KpnI and ApaI restriction sites The homologous right arm of SEQ ID NO.2. The homologous left arm sequence containing ApaI and BamHI restriction sites and the backbone vector pEGFP-C1 (commercialized vector, available for purchase) containing the same restriction site (sequence is SEQ ID NO.7) were respectively subjected to BamHI single enzyme After being recovered from the gel, ligated with T4 ligase, ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
