Schizochytrium sp alpha-tubulin related sequence and application thereof

A technology of tubulin and nucleotide sequences, which is applied in the fields of application, microbial measurement/inspection, and the use of vectors to introduce foreign genetic materials. It can solve the problems of obtaining sequences, unclear gene sequences to be tested, and inability to confirm.

Active Publication Date: 2016-05-11
WILMAR SHANGHAI BIOTECH RES & DEV CENT
View PDF14 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This work is relatively simple for microorganisms with episomal plasmids, but it is very troublesome for microorganisms without episomal plasmids, because the vector used for trap must be integrated into the genome, which requires that the vector must have the host genome. Therefore, after the trap vector enters the cell, it will be integrated at the homologous site of the fragment to be screened, which will bring great trouble to the su

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Schizochytrium sp alpha-tubulin related sequence and application thereof
  • Schizochytrium sp alpha-tubulin related sequence and application thereof
  • Schizochytrium sp alpha-tubulin related sequence and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0088] According to the published sequence of Schizochytrium α-tubulin promoter, design the upstream primer:

[0089] TubU: 5'ACAAGGTCGATAAACTAAGCTCCTCAC (SEQ ID NO: 4);

[0090] Design several downstream primers based on tubulin conservation:

[0091] 31: TGATGCGCTCGAGCTGGAGGT (SEQ ID NO: 5);

[0092] 206: TAGTGGCCCTTGGCCCAGTTGTTGC (SEQ ID NO: 6);

[0093] 300: GTGGGTGATCTGGAAGCCCTGGAGGCAG (SEQ ID NO: 7);

[0094] 547: GGGTGGTGAGCTTGAGGGTGCGGAAG (SEQ ID NO: 8);

[0095] 796: CGGCGCACATCATGTTCTTGGCAT (SEQ IDNO: 9);

[0096] In YPDS medium (10g / L yeast powder, peptone 10g / L, glucose 10g / L, sea salt 18g / L, pH6.8), culture Schizochytrium (ATCC20888) on a shaker at 28℃, 200rpm for 3 days, centrifuge at 6000rpm After 10 minutes of collecting the bacteria, they were ground into powder in liquid nitrogen immediately, and the genomic DNA was extracted using Takara's 9770QDNAiso reagent. Using Schizochytrium genomic DNA as a template, Takara's Ex-taq enzyme was used for amplification. All the PC...

Embodiment 2

[0116] The comparison results of BlastN (nucleic acid sequence alignment) are shown in Table 1:

[0117] Table 1: The results of comparison of the tubulin nucleic acid sequence obtained by the present invention on GeneBank

[0118]

[0119]

[0120] The sequence of the termination region was aligned on GENEBANK, and it was found that no sequence had enough homology to this sequence as reported by Blastn. Obviously, these are two new sequences, and the highest target for amino acid identity in the coding region is Phytophthorainfestans, which belongs to the class of Oomycetes (stramenopiles) with the Thraustochytrium family. The highest similarity of nucleic acid comparison is Micromonas. There have not been any published alpha-tubulin sequences for Schizochytrium, Thraustochytrium, and Thraustochytrium.

Embodiment 3

[0122] Using the 3'non-coding region of the tubulin as the target region for homologous integration, site-directed recombination is performed. According to this idea, a vector for Schizochytrium recombination was constructed.

[0123] Using the primers RmlMaU: aaaccatggGAAATCAACGAACTTAC (SEQ ID NO: 17) and RmlDSal: aaaGTCGACagtacacaaaccggtgttaat (SEQ ID NO: 18), using the RML gene vector as a template, amplify the RML lipase gene so that the 5'and 3'ends of the RML lipase gene are digested with NcoI and SalI, respectively Site. The PCR system is 18.1μl of water, 2μl of dNTPs (2.5mM each), 2.5μl of 10×PCR buffer, 1μl of 20uM primers, 0.4μl of rTaqDNA polymerase; PCR reaction conditions are: 95°C for 5 minutes; 30 cycles of 95°C for 50s 、52℃50s, 72℃1min; 72℃10min. After the PCR product was purified by Omega's CyclePure kit, it was digested with NcoI and SalI restriction enzymes. The digestion conditions were carried out in accordance with the product instructions. The total diges...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a schizochytrium sp alpha-tubulin related sequence and application of the schizochytrium sp alpha-tubulin related sequence, in particular to a schizochytrium sp alpha-tubulin gene sequence as shown in SEQ ID No.1, a schizochytrium sp alpha-tubulin sequence as shown in SEQ ID No: 2 and a schizochytrium sp alpha-tubulin gene 3'end noncoding region sequence as shown in SEQ ID No: 3. The invention further relates to fragments of the gene sequences, recombinant nucleic acid molecules containing the gene sequences or fragments of the gene sequences, application of the recombinant nucleic acid molecules to homologous recombination, and a method for gene function analysis by using the recombinant nucleic acid molecules.

Description

Technical field [0001] The invention belongs to the field of genetic engineering, and specifically relates to a Schizochytrium alpha-tubulin related sequence and its application. Background technique [0002] Schizochytriumsp (Schizochytriumsp) grows rapidly, the biomass can reach 200g / L, and the DHA yield can reach 0.69g / L.h (CN1416320A). If it can produce enzyme proteins and maintain such high growth performance, it is obviously an excellent engineering bacteria group. With high-density fermentation, fast growth, and few extracellular proteins, Schizochytrium has the potential to become a host for foreign gene expression. [0003] Disclosures of using Schizochytrium to express foreign genes at home and abroad, such as Bayne et al.’s extracellular expression of recombinant hemagglutinin (Hemagglutinin) [BayneAC, BoltzD, OwenC, etc., Vaccinationagainstinfluenzawithrecombinanthemagglutininexpressedby Schizochytriumsp.confersprotectiveimmunity,PLOS,102648207A]; CN SexI secretion si...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/62C12N15/29C07K14/415C12N15/80C12Q1/68
Inventor 戴小军许骏谢文娴
Owner WILMAR SHANGHAI BIOTECH RES & DEV CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap