Schizochytrium α-tubulin related sequence and its application

A technology for tubulin and Schizochytrium, which is applied to Schizochytrium alpha-tubulin-related sequences and their application fields, can solve problems such as troublesome, difficult, and unconfirmed

Active Publication Date: 2021-06-29
WILMAR SHANGHAI BIOTECH RES & DEV CENT
View PDF14 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This work is relatively simple for microorganisms with episomal plasmids, but it is very troublesome for microorganisms without episomal plasmids, because the vector used for trap must be integrated into the genome, which requires that the vector must have the host genome. Therefore, after the trap vector enters the cell, it will be integrated at the homologous site of the fragment to be screened, which will bring great trouble to the subsequent work of obtaining the sequence, because only the sequence on the reporter gene side of the sequence to be obtained is clear. I don’t know the sequence at the other end of the gene to be tested, so I can only amplify it little by little through the strategy of genome walk-reading, which is difficult and complicated; moreover, it is impossible to confirm how long the functional fragment should be, requiring a lot of inspection work

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Schizochytrium α-tubulin related sequence and its application
  • Schizochytrium α-tubulin related sequence and its application
  • Schizochytrium α-tubulin related sequence and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0088] According to the published Schizochytrium α-tubulin promoter sequence, design upstream primers:

[0089] TubU: 5'ACAAGGTCGATAAACTAAAGCTCCTCAC (SEQ ID NO:4);

[0090] Design several downstream primers according to tubulin conservation:

[0091] 31: TGATGCGCTCGAGCTGGAGGT (SEQ ID NO: 5);

[0092] 206: TAGTGGCCCTTGGCCCAGTTGTTGC (SEQ ID NO: 6);

[0093] 300: GTGGGTGATCTGGAAGCCCTGGAGGCAG (SEQ ID NO: 7);

[0094] 547: GGGTGGTGAGCTTGAGGGTGCGGAAG (SEQ ID NO: 8);

[0095] 796: CGGCGCACATCATGTTCTTGGCAT (SEQ ID NO: 9);

[0096] In YPDS medium (10g / L yeast powder, peptone 10g / L, glucose 10g / L, sea salt 18g / L, pH 6.8), cultivate Schizochytrium (ATCC 20888) on a shaker at 28°C for 3 days at 200rpm, and centrifuge at 6000rpm After 10 minutes of collection, the bacteria were immediately pulverized in liquid nitrogen, and the genomic DNA was extracted using 9770Q DNAiso reagent from Takara Company. Genomic DNA of Schizochytrium was used as a template to amplify using Ex-taq enzyme ...

Embodiment 2

[0116] The comparison results of BlastN (nucleic acid sequence alignment) are shown in Table 1:

[0117] Table 1: The results of comparison of tubulin nucleic acid sequences obtained in the present invention on GeneBank

[0118]

[0119]

[0120] The sequence of the termination region was compared on GENEBANK, and it was found that no sequence had enough homology with this sequence to be reported by Blastn. Obviously, these are two new sequences, and the highest amino acid identity in the coding region is Phytophthorainfestans, which belongs to the class Oomycetes (stramenopiles) with Thraustochytriaceae. The highest similarity in nucleic acid comparison was Micromonas. No α-tubulin sequence has been published for Schizochytrium, Thraustochytriaceae, Thraustochytrides yet.

Embodiment 3

[0122] Site-directed recombination was performed using the 3' non-coding region of the above-mentioned tubulin as the target region for homologous integration. According to this idea, a vector for Schizochytrium recombination was constructed.

[0123] Using primers RmlMaU: aaaccatggGAAATCAACGAACTTAC (SEQ ID NO: 17) and RmlDSal: aaaGTCGACagtacacaaaccggtgttaat (SEQ ID NO: 18), the RML gene vector was used as a template to amplify the RML lipase gene, so that the 5' and 3' ends were respectively carrying Nco I and Sal I restriction sites. The PCR system is 18.1 μl of water, 2 μl of dNTPs (2.5 mM each), 2.5 μl of 10×PCR buffer, 1 μl of each 20uM primer, 0.4 μl of rTaq DNA polymerase; the PCR reaction conditions are: 95°C for 5 minutes; 30 cycles of 95 50s at ℃, 50s at 52℃, 1min at 72℃; 10min at 72℃. After the PCR product was purified by Omega’s Cycle Pure kit, it was double-digested with Nco I and Sal I restriction endonucleases. The digestion conditions were carried out accordi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to Schizochytrium α-tubulin-related sequences and applications thereof, in particular to the Schizochytrium α-tubulin gene sequence shown in SEQ ID NO:1, the schizochytrium α-tubulin gene sequence shown in SEQ ID NO:2 Chytrium α-tubulin sequence and the 3' non-coding region sequence of Schizochytrium α-tubulin gene shown in SEQ ID NO:3. The present invention also relates to fragments of these gene sequences, recombinant nucleic acid molecules containing said gene sequences or fragments thereof, applications of these recombinant nucleic acid molecules in homologous recombination, and methods for analyzing gene functions using these recombinant nucleic acid molecules.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and specifically relates to a sequence related to Schizochytrium α-tubulin and its application. Background technique [0002] Schizochytrium sp grows rapidly, the biomass can reach 200g / L, and the DHA yield can reach 0.69g / L.h (CN 1416320A). If it can produce enzyme protein and maintain such a high growth performance, it is obviously an excellent engineering bacteria group. Capable of high-density fermentation, rapid growth, and few extracellular proteins, Schizochytrium has the potential to become a host for exogenous gene expression. [0003] Domestic and foreign publications on the use of Schizochytrium sp. to express foreign genes, such as Bayne et al. [Bayne AC, Boltz D, Owen C, etc., Vaccination against influenza with recombinant hemagglutinin expressed by Schizochytrium sp. confersprotective immunity , PLOS, 8 (4)]; CN102648207A discloses the secretion expression mediated by SexI secre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/62C12N15/29C07K14/415C12N15/80C12Q1/6895
Inventor 戴小军许骏谢文娴
Owner WILMAR SHANGHAI BIOTECH RES & DEV CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap