Recombinant tuberculosis vaccine, preparation method and application thereof

A technology of recombinant virus and recombinant virus vector, which is applied in the fields of bioengineering and immunization, can solve the problems of great changes in tuberculosis protection ability, insufficient immune effect, and inability to apply to immunodeficiency patients, etc.

Active Publication Date: 2018-07-03
SHANGHAI INST OF BIOLOGICAL PROD CO LTD
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The traditional vaccine Bacillus Calmette-Guerin (BCG) is the only vaccine to prevent tuberculosis in the world today. The long-term use results show that its immune effect is insufficient. BCG can prevent tuberculosis in children to a certain extent, but its protective ability against tuberculosis in adults varies greatly (0-80%), and cannot be applied to immunocompromised patients; at the same time, with the increase of population flow, the emergence of multidrug-resistant tuberculosis strains, the occurrence of concurrent infection of Mycobacterium tuberculosis and HIV, and the limitations of BCG vaccination protection The incidence of tuberculosis has shown a clear upward trend in the world, but there is no new vaccine that can completely replace BCG

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant tuberculosis vaccine, preparation method and application thereof
  • Recombinant tuberculosis vaccine, preparation method and application thereof
  • Recombinant tuberculosis vaccine, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] Embodiment 1, p5Ag (Kozak-TPA-pAg85B-ESAT6-Rv1733c-Rv2626c-RpfD) recombinant plasmid construction

[0086] In this example, the target fragment was inserted into the expression plasmid to construct the recombinant plasmid p5Ag (pKozak-TPA-Ag85B-ESAT6-Rv1733c-Rv2626c-RpfD).

[0087] 1.1 Obtain the digested vector

[0088] Prepare the enzyme digestion system as shown in Table 1.

[0089] Table 1 (μl)

[0090] Sample name

expression plasmid pA

10×O buffer

EcoRI

SalI

wxya 2 o

carrier

20

4.5

1

1

46

[0091] After mixing, react at 37°C for 2 hours. The digested product was purified with the nucleic acid gel recovery kit TIANgel MidiPurification Kit to obtain 40 μl of the product.

[0092] 1.2 Obtain the insert fragment after enzyme digestion

[0093] Prepare the enzyme digestion system as shown in Table 2.

[0094] Table 2 (μl)

[0095]

[0096] After mixing, react at 37°C for 1 hour. The digested product wa...

Embodiment 2

[0112] Embodiment 2, construction of p4Ag (pKozak-TPA-ESAT6-Rv1733c-Rv2626c-RpfD) recombinant plasmid

[0113] In this example, the target fragment was inserted into the expression plasmid to construct the recombinant plasmid p4Ag (pESAT6-Rv1733c-Rv2626c-RpfD).

[0114] 1. Obtain and amplify the Kozak-TPA-ESAT6 (370bp) fragment by PCR

[0115] 4Ag forward primer (SEQ ID NO: 7): cgaattcgccaccatggacgccatgaagaggggcctgtgttgcgtgctgctcctgtgtggcgccgtgttcgtgagccccagcaccgagcagcagtgga

[0116] 4Ag reverse primer (SEQ ID NO: 8): gcttcgaaggcgaacatgccggtcaca

[0117] Template: p5Ag (pAg85B-ESAT6-Rv1733c-Rv2626c-RpfD) or Mycobacterium tuberculosis H37Rv genome.

[0118] The reaction system is shown in Table 5.

[0119] Table 5. PCR reaction system (μl)

[0120]

[0121] PCR reaction conditions: 95°C for 3 minutes → (95°C for 30 seconds → 70°C for 30 seconds → 72°C for 60 seconds) 30 cycles → 72°C for 10 minutes.

[0122] Recovery of PCR products: PCR products were purified with TIAN...

Embodiment 3

[0146] Embodiment 3, acquisition, amplification and identification of recombinant viral particles

[0147] In this example, the two recombinant expression plasmids prepared in Example 1-2 were introduced into vaccinia virus MVA by homologous recombination.

[0148] 1. Recombinant expression plasmid transfected with vaccinia virus

[0149] 1.1 Prepare BHK21 cells in logarithmic growth phase and infect 0.1 PFU of vaccinia virus MVA strain.

[0150] 1.2 One hour after MVA infection, remove the virus liquid, replace with new double-antibody-free medium and incubate at 37°C for 2 hours, and transfect the above two recombinant expression plasmids respectively.

[0151] 1.3 Harvest the virus after culturing at 37°C for 3 days, and freeze and thaw repeatedly 3 times.

[0152] 1.4 Re-infect BHK21 cells with the frozen-thawed cell lysate, and culture with MPA selection medium at 37°C for 2-5 days.

[0153] 1.5 Pick a single viral plaque, amplify it, and identify the picked clones. T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant tuberculosis vaccine, a preparation method and an application thereof. The vaccine can enhance the special I type cellular immunity of an inoculated crowd body effectively and strengthen the immune protective force of the inoculated crowd on mycobacterium tuberculosis. The vaccine matched with a bcg vaccine in use can change the condition that single use of the BCG is non-effective to part of individuals and crowds infected with mycobacterium tuberculosis, so that the aim of reducing the tuberculosis incidence rate is achieved.

Description

technical field [0001] The invention belongs to the field of bioengineering and immunization, and more specifically, the invention relates to a recombinant tuberculosis vaccine, its preparation method and application. Background technique [0002] Tuberculosis (TB) has become the most serious infectious disease threatening human health in the world today. According to WHO statistics, there are about 20 million tuberculosis patients in the world, with about 9 million new cases in 2013, and nearly 2 million people die of tuberculosis every year. In China, 550 million people are infected with tuberculosis, and the annual incidence is about 1.3 million, ranking second in the world. [0003] The causative bacterium of tuberculosis is Mycobacterium tuberculosis, which belongs to the genus Mycobacterium in the family Mycobacteriaceae. Mycobacterium tuberculosis is mainly transmitted through the respiratory tract, and can also enter the human body through the digestive tract. Aft...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/86C12N15/861C12N15/863C12N7/01A61K39/04A61P31/06
CPCA61K39/04A61K2039/5256C12N7/00C12N15/86C12N2710/10043C12N2710/16043C12N2710/24043C12N2770/24043A61K2300/00
Inventor朱琳杨炯明张群托马斯·G·伊凡斯拉维·P·阿娜扎肯尼斯·巴里·沃克楼觉人
OwnerSHANGHAI INST OF BIOLOGICAL PROD CO LTD