Application of Rv1773c in preparing drug for resisting infection of mycobacterium tuberculosis

A technology of Mycobacterium tuberculosis, rv1773c, applied in the application field of medicine, can solve problems such as increasing patient burden and drug resistance

Active Publication Date: 2018-08-14
WUHAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In order to avoid the emergence of drug resistance during drug treatment, the combination of anti-tuberculosis drugs is often used in clinical practice, but this undoubtedly increases the burden on patients.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Rv1773c in preparing drug for resisting infection of mycobacterium tuberculosis
  • Application of Rv1773c in preparing drug for resisting infection of mycobacterium tuberculosis
  • Application of Rv1773c in preparing drug for resisting infection of mycobacterium tuberculosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] [Example 1] Construction and identification of recombinant expression plasmids of 18 ORFs in M.tb RD10-16 region and recombinant mycobacteria

[0021] Extract the H37Rv genome, design primers for the H37Rv RD10-16 region (Table 1), and amplify the corresponding genes. The specific steps are as follows: use the bacterial genomic DNA extraction kit to extract the H37Rv genome as a template for PCR reactions. PCR system and process of RD10-16 region gene: 1 μL each of primers P1 and P2 (concentration is 10 μM), genomic DNA 1 μL (concentration is 105 ng / μL), 2×Mix 25 μL, add sterile deionized water to a final volume of 50 μL . The PCR amplification conditions are: under the action of Taq DNA polymerase, pre-denaturation at 95°C for 4 minutes; denaturation at 95°C for 20 s, annealing at 58°C for 30 s (the temperature of this step is fine-tuned according to the annealing problem of the primers of each gene), and extension at 72°C for 30 s for a total of 30 s. cycle; the fina...

Embodiment 2

[0026] [Example 2] Distribution of Rv1773cc in RD14 region in different mycobacteria

[0027] Using each mycobacterial genome as a template, Rv1773c-specific primers P1: 5'CGGATCCTTGGGTTCAACAGGAGG3' (containing the BamHI restriction site), P2: 5'ATTAAGCTTCGCCGCCGCATG3' (containing the HindIII restriction site) were used for PCR. Detect the expression of Rv1773c in different mycobacteria, such as figure 1 As shown, Rv1773c is mainly highly expressed in H37Rv and H37Ra, lowly expressed in Mycobacterium intracellulare and Mycobacterium avium, and not expressed in Mycobacterium smegmatis, Mycobacterium marinum and BCG.

Embodiment 3

[0028] [Example 3] Screening and identification of Rv1773c in the RD14 region significantly promotes the invasion of Mycobacterium tuberculosis to macrophages

[0029] A 24-well cell plate was spread with RAW264.7 cells (the cell density was 2×10 5 / well), in a 24-well plate, rM.s::Rvs was infected with RAW264.7 macrophages at an MOI of 10:1 for 30 minutes, followed by gentamicin for 1 hour to remove and kill extracellular non-invasive The bacteria were cultured in a cell incubator (wild-type M.s and rM.s::pMV261 control groups were set). Wash 3 times with sterile PBS, scrape it off with a cell scraper, transfer to a 1.5ml EP tube, and centrifuge at 300g to discard the supernatant to remove excess bacteria or cell debris that may remain. 200 μl of 0.02% Triton-x-100 cell lysate was used to resuspend the cell pellet after centrifugation in the previous step. After 3 minutes of action, the pellet was collected by centrifugation at 12,000 rpm / min, that is, the mixture of cell deb...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses application of Rv1773c in preparing a drug for resisting infection of mycobacterium tuberculosis and belongs to the technical field of biology. The invention determines that functional protein Rv1773c of the mycobacterium tuberculosis can promote the mycobacterium tuberculosis to intrude macrophage. The Rv1773c can be used as a novel drug target for resisting tuberculous infection. The results provided by the invention can provide a novel tool and an idea for preventing and treating clinical tuberculosis; particularly, the Rv1773c has a broad prospect in the aspects ofdevelopment, clinical application and the like of anti-tuberculosis drugs and vaccine, or can be directly applied to the field of scientific research or guides the development of an inhibitor for inhibiting the intrusion of the mycobacterium tuberculosis to host macrophages. The Rv1773c disclosed by the invention has important application value of obtaining a novel antituberculous drug target andscreening a novel drug.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to the application of the mycobacterium tuberculosis pathogenic protein Rv1773c as an important target site for designing and screening anti-tuberculosis drugs in the preparation of anti-mycobacterium tuberculosis infection drugs. Background technique [0002] Tuberculosis is a chronic infectious disease that seriously endangers the health of humans and animals. Tuberculosis caused by Mycobacterium tuberculosis is a zoonotic tuberculosis. Nearly one-third of the world's population is currently infected with Mycobacterium tuberculosis. According to WHO's "Global Tuberculosis Report 2016", it is estimated that there will be 10.4 million new tuberculosis cases in 2015, and 1.4 million deaths due to tuberculosis, exceeding the death toll from other infectious diseases. sum. The number of tuberculosis patients in my country ranks third in the world. [0003] The number of multid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/04C12R1/32
CPCC12Q1/04C12Q1/689C12Q2600/136C12Q2600/158
Inventor 章晓联刘伟香
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap