Quality detection method of Dendrobium chrysotoxum Lindley

A quality inspection method and technology of Dendrobium Dendrobium, applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve the problems such as the inability to fully reflect the overall curative effect, and achieve the goal of interpretation pertinence and applicability, accurate quality evaluation, and solution dimension. effects of disaster

Active Publication Date: 2018-08-14
蓝标一成(海南)生物科技有限公司
View PDF14 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In traditional Chinese medicine under the guidance of traditional Chinese medicine theory, any ac

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quality detection method of Dendrobium chrysotoxum Lindley
  • Quality detection method of Dendrobium chrysotoxum Lindley
  • Quality detection method of Dendrobium chrysotoxum Lindley

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] The generation sequencing of embodiment 1 Dendrobium drumsticks

[0053] First-generation sequencing primer sequences:

[0054] ITS-26SE: 5'GAATTCCCCGGTTCGCTCGCCGTTAC 3';

[0055] ITS-17SE: 5' ACGAATTCATGGTCCGGTGAAGTGTTCG 3'.

[0056] The amplification and sequencing parameters are: denaturation at 98°C for 2 minutes and then PCR cycle, the PCR cycle parameters are 98°C for 20s; 52°C for 30s; 68°C for 1min, 38 cycles, 68°C for 7min, set 4°C after the amplification, and perform Generation Molecular Sequencing.

[0057] Through the first-generation sequencing, the species of Dendrobium to be tested was identified as Dendrobium chrysalis.

Embodiment 2

[0058] The extraction method of embodiment 2 Dendrobium drumsticks

[0059] Take the dried sample of Dendrobium chrysalis, pulverize it with a pulverizer, pass through a pharmacopoeia sieve (aperture 0.335mm), accurately weigh 1.000g of Dendrobium powder (the weighing error cannot exceed 0.2%), place it in a 100ml Erlenmeyer flask, add 50mL of 75 % methanol (V water: V methanol = 25:75), take it out after ultrasonication for 30 minutes at room temperature, filter, and concentrate the filtrate to dryness by rotary evaporation, dissolve it with 75% methanol solvent (V water: V methanol = 25:75), and finally transfer Dilute to a 10ml volumetric flask, shake well, and filter with a 0.45 μm microporous membrane to obtain a sample solution of Dendrobium chrysalis.

Embodiment 3

[0060] The chromatographic detection method of the Dendrobium drumstick extract of embodiment 3

[0061] ①Preparation of reference solution

[0062] Accurately weigh 4.10 mg of Schaftoside and 4.08 mg of naringenin, place them in 10 ml volumetric flasks, add 75% (V / V) methanol to dissolve and dilute, shake well, and use them as stock solutions. Refrigerate at 4°C for later use.

[0063] Then accurately draw a certain amount of reference substance stock solution and dilute with 75% methanol to accurately prepare a mixed reference substance solution of schaffertoside and naringenin. Through different dilution ratios, 7 concentration points of the prepared components were diluted. into a high performance liquid chromatograph.

[0064] ②Extraction and processing method of samples for determination of small molecular components of Dendrobium drumsticks:

[0065] Take 1.00g of the powder of this product (passed through a No. 3 sieve), accurately weigh it, put it in a 100ml volum...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a quality detection method of Dendrobium chrysotoxum Lindley. The quality detection method comprises: 1) sequencing by using ITS-26SE and ITS-17SE as primers to identify the variety of a to-be-detected Dendrobium herb; 2) carrying out chromatographic detection on n samples to obtain detection data using a chemical small molecule component schaftoside and/or naringenin as areference component; 3) respectively carrying out fingerprint detection on the samples to obtain the fingerprint peak area value of the full chemical components of Dendrobium chrysotoxum Lindley; and4) establishing an analysis model by using the content value of the schaftoside and/or naringenin in the chromatographic data as the response variable and using the peak area value of other componentsin the fingerprint as the independent variable, screening the variable through a Lasso method, and establishing the characteristic fingerprint model related to the chemical small molecule component.According to the present invention, through the first-generation sequencing and the characteristic fingerprinting, the quality of Dendrobium chrysotoxum Lindley is precisely identified and controlled.

Description

technical field [0001] The invention belongs to the field of detection and analysis of components of traditional Chinese medicines, and in particular relates to a quality detection method of Dendrobium drumsticks. Background technique [0002] Drumstick Dendrobium (Dendrobium chrysotoxum Lindley): the stem is erect, fleshy, spindle-shaped, 6cm-30cm long, 1.5cm-5cm in diameter in the middle, with 2-5 internodes, with many blunt ribs, golden yellow after drying, There are 2-5 leaves near the top; the leaves do not descend and extend into sheaths covering the stem. Racemes emanating from near the top of the stem. Oblique or slightly drooping, up to 20cm; rachis of inflorescence thick, sparsely numerous flowers; base of inflorescence peduncle with 4-5 sheaths; flower bracts small, membranous, ovate-lanceolate, 0.2cm-0.3cm long, The apex is acute; the pedicel and ovary are yellow, up to 5cm; the flower texture is thick, golden yellow, slightly fragrant; the middle sepal is oblo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): G01N30/86
CPCG01N30/86
Inventor 赵田刘仲健
Owner 蓝标一成(海南)生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap