Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of interfering long-chain non-coding RNA PVT1 expression agent in the preparation of nasopharyngeal carcinoma radiotherapy sensitizer

A long-chain non-coding, radiotherapy technology for nasopharyngeal carcinoma, applied in DNA/RNA fragments, recombinant DNA technology, medical preparations containing active ingredients, etc., can solve the problem that radiation cannot completely kill tumor cells, poor prognosis, and patient death And other issues

Active Publication Date: 2018-09-21
CENT SOUTH UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Nasopharyngeal carcinoma is a common and high-incidence head and neck malignant tumor, prone to cervical lymph node metastasis, and the prognosis is poor. Radiation therapy is currently the main clinical treatment for nasopharyngeal carcinoma. Some patients with nasopharyngeal carcinoma have radiation resistance due to cancer cells ( Radioresistance), that is, insensitivity to radiation therapy, radiation cannot completely kill tumor cells, and the remaining tumor cells eventually recur and metastasize, leading to the death of patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of interfering long-chain non-coding RNA PVT1 expression agent in the preparation of nasopharyngeal carcinoma radiotherapy sensitizer
  • Application of interfering long-chain non-coding RNA PVT1 expression agent in the preparation of nasopharyngeal carcinoma radiotherapy sensitizer
  • Application of interfering long-chain non-coding RNA PVT1 expression agent in the preparation of nasopharyngeal carcinoma radiotherapy sensitizer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1, real-time fluorescent quantitative PCR method detection confirmed that PVT1 was up-regulated in nasopharyngeal carcinoma

[0062] 1. Materials and methods:

[0063] 32 cases of normal nasopharyngeal epithelial tissues and 61 cases of nasopharyngeal carcinoma tissues were collected, total RNA was extracted, 2 μg RNA was reverse transcribed into cDNA, and real-time fluorescent quantitative PCR was performed. PVT1 forward primer is 5'-TGG CTG AGA GGG TTG AGA TC-3' as shown in SEQ NO:2, and reverse primer 5'-GCT GTA TGT GCC AAG GTC AC-3' as shown in SEQ NO:3 .

[0064] The GAPDH forward primer used for the control is 5'-ACCACAGTCCATGCCATCAC-3' as shown in SEQ NO:4, and the reverse primer 5'-TCCACCACCCTGTTGCTGTA-3' as shown in SEQ NO:5.

[0065] Real-time fluorescence quantitative PCR reaction system

[0066]

[0067] Real-time fluorescent quantitative PCR reaction steps

[0068]

[0069]

[0070] After the reaction, the amplification curve and meltin...

Embodiment 2

[0072] Example 2, In situ hybridization detection found the expression of PVT1 in nasopharyngeal carcinoma, and its correlation with patient prognosis and radiotherapy sensitivity

[0073] 1. Material method

[0074] 1.1 Design and synthesis of hybridization probes

[0075] In order to detect the expression of PVT1 by in situ hybridization, we designed two groups of oligonucleotide probes for detection of PVT1 expression by in situ hybridization and three positive control in situ hybridization oligonucleotide probes.

[0076] Oligonucleotide probes for detection of PVT1 expression by in situ hybridization:

[0077] PVT1 probe 1: 5'-GGTCGGACTAGAAAACCGGTCTTCCTCTAATTTT-3' as shown in SEQ NO:6,

[0078] PVT1 probe 2: 5'-GAGACTGTAAAAACTTCTCAGGTCTTAGGA-3' as shown in SEQ NO:7,

[0079] PVT1 probe 3: 5'-CTCATAAAACTCTAACCTCTTAATTCTCGGTCAG-3' is shown in SEQ NO:8.

[0080] Positive control probe (to detect the housekeeping gene GAPDH):

[0081] GAPDH probe 1: 5'-CCACTTTACCAGAGTTAA...

Embodiment 3

[0143] Example 3, construction of shRNA vectors to interfere with the expression of PVT1

[0144] 1. Material method

[0145] 1.1 Reagents and kits

[0146] Restriction enzymes Hind III, Bgl II, EcoR I and Cla I, T4 DNA ligase, etc. were purchased from TakaRa;

[0147] TRIZOL TM Reagent (Invitrogen);

[0148] Plasmid Extraction Kit (#D6943-01, OMEGA);

[0149] Gel recovery kit (#M5212, OMEGA);

[0150] Reverse transcription kit (#A3500, Promega);

[0151] Antibiotic G418 (Ameresc).

[0152] 1.2 Design of shRNA

[0153] First, input the PVT1 sequence into Invitrogen's Block-It RNAi designer software to find the best shRNA target of the lncRNA, and select the best 3 corresponding target sequences as follows:

[0154] shRNA-1: GGACTTGAGAACTGTCCTTA as shown in SEQ NO: 12,

[0155] shRNA-2: GCTTCTCCTGTTGCTGCTAGT as shown in SEQ NO: 13,

[0156] shRNA-3: GCTCCACCCAGAAGCAATTCA shown in SEQ NO: 14,

[0157] The widely used Scramble sequence without any target in the human ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses an application of interfering long-chain non-coding RNA PVT1 expression agent in the preparation of nasopharyngeal carcinoma radiotherapy sensitizer. After the expression of PVT1 is inhibited by introducing an interference vector (siPVT1) targeted to PVT1 in the nasopharyngeal carcinoma cell lines CNE2 and 5-8F, the cells are irradiated with radiation of 0, 2, 4, 6, and 8Gy, respectively, and the cells continues to culture for 12 days, and the colony-forming experiments are compared with a negative control (NC, cells transfected with scramble interference vector), afterinhibiting PVT1 expression, the number of colonies formed by CNE2 and 5-8F cells is significantly reduced, which indicates that the cells are more sensitive to radiation therapy, and the interferingwith long-chain non-coding RNA PVT1 expression agents could be used to prepare the radiotherapy sensitizer for nasopharyngeal carcinoma.

Description

technical field [0001] The invention belongs to the field of tumor molecular biology, and in particular relates to the application method of a reagent that interferes with the expression of long-chain non-coding RNA PVT1 in preparing a radiosensitizer for nasopharyngeal carcinoma. Background technique [0002] Human Genome Project and its follow-up DNA Elements Encyclopedia Project (The Encyclopedia of DNAElements Project, ENCODE) research results show that protein-coding gene sequences only account for 1-3% of the human genome sequence, while most of the human genome can be transcribed The sequence is long non-coding RNA (Long non-coding RNA, lncRNA). LncRNAs widely exist in various organisms, and with the increase of biological complexity, the proportion of lncRNA sequences in the genome increases accordingly, suggesting that lncRNAs are of great significance in the process of biological evolution. As lncRNAs are continuously discovered and their functions are gradually i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/70C12N15/66A61K31/713A61P35/00
CPCA61K31/713C12N15/1135C12N15/70C12N2310/14C12N2310/531
Inventor 熊炜曾朝阳李桂源何奕郭灿熊芳魏芳唐艳艳杨丽婷王裕民龚朝建张姗姗
Owner CENT SOUTH UNIV