Therapeutic T cells
A technology of cells and cell receptors, applied in the field of immunotherapy, to achieve the effect of overcoming tumor editing and reducing the impact
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0238] Materials and methods
[0239] Cxcr4 clone from murine BM
[0240] Cxcr4 clones from murine BM messenger RNA were extracted from murine bone marrow using the Qiagen RNAeasy kit according to the manufacturer's instructions. RT-PCR was performed on isolated mRNA using Invitrogen DNA polymerase and buffer to generate cDNA. The mRNA sequence for murine Cxcr4 was obtained from the online NCBI Nucleotide Reference Library (NCBI Accession No. NM_009911) and primers designed to flank the Cxcrf coding sequence. Starting the 5' primer with the sequence of the Notl restriction endonuclease and the 3' primer with the SacI sequence produces a PCR product in which these restriction sites flank the subsequently amplified DNA. These primers were then used to amplify CXCR4 DNA:
[0241] 5'Not1 primer: TAAATATTGCGGCCGCATGGAACCGATCAGTG (SEQ ID NO: 6)
[0242] 3'Sal1 primer: GATTGTCGACTTAGCTGGAGTGAAAACTGG (SEQ ID NO: 7)
[0243] CXCR4-GFP retroviral vector production
[0244] The mur...
Embodiment 2
[0255] Materials and methods
[0256] OT-1 T cells (CD45.1+ or Thy1.1+) were transduced with CXCR4-IRES-GFP or control IRES-GFP vector, mixed at a ratio of 1:1, and injected into B6CD45.2+Rag- / - mice (1×10 per group 6 cells). On days 1 and 29, mice were vaccinated at the base of the tail with 200 [mu]M SIINFEKL (related) or an unrelated peptide in incomplete Freund's adjuvant (IFA). Mice were sacrificed at indicated time points, BM, spleens and LNs were harvested, and the relative numbers of CXCR4- or control vector-transduced cells were assessed by FAC.
[0257] result
[0258] These data demonstrate that OT-1CD8+ T cells transduced with pMP71-CXCR4-IRES-GFP outperform cells transduced with vector control, recalling immune responses to antigen, especially in the spleen and bone marrow ( figure 2 ). Therefore, T CXCR4 exhibited better memory properties than control cells.
Embodiment 3
[0260] Materials and methods
[0261] The experimental plan was as described in Example 2. For cell surface staining, cells were stained at up to 1 x 10 6 Amount per well was plated in 96 well round bottom plates. Cells were resuspended in 50 μl of FACS buffer (2% FCS in PBS) with appropriate concentrations of the indicated fluorochrome-conjugated antibodies. Plates were then incubated for 20 minutes at 4°C in the dark. Wells were then made up to 200 μl with FACS buffer and washed again. Stained cells were then resuspended in 200 μl FACS buffer ready for FACS analysis. For intracellular staining, cells were initially stained with surface antibodies as described above. Cells were then washed in MACS buffer and washed in 200 μl of 1% formaldehyde fixation / permeabilization solution (Cytofix / Cytoperm-BD), incubated at 4°C for 15 min, and in 0.5% saponin (Perm / Wash buffer-BD ), resuspend in 50 μl Perm / Wash supplemented with fluorescently labeled anti-bcl2 antibody or isotype ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More