Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bostrychus sinensis vitellogenin full-length gene, cloning method thereof and application thereof

A technology of Chinese snakehead and vitellogenin, applied in the fields of molecular biology and environmental science, to achieve accurate response, good response to water quality and water environmental pollution status

Active Publication Date: 2019-12-31
XIAMEN UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no report about the Vtg gene and its full-length cDNA sequence of Channa sinensis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bostrychus sinensis vitellogenin full-length gene, cloning method thereof and application thereof
  • Bostrychus sinensis vitellogenin full-length gene, cloning method thereof and application thereof
  • Bostrychus sinensis vitellogenin full-length gene, cloning method thereof and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] A method for cloning the full-length sequence of Channa sinensis Vtg gene, the method comprising the steps of:

[0068] 1. Apply 17β-estradiol (E2) to induce male S. sinensis, extract total RNA from the liver tissue of E2-induced S. sinensis male, and carry out reverse transcription amplification;

[0069] 2. Download 16 fish genes with close relatives in genebank, use DNAMAN for comparison, and design PCR primers:

[0070] Vg-CDS-F: ATGAGAGYNGTTGTRCTWGC

[0071] Vg-CDS-R: CAGCCTTTTCCACAAGWCCAC

[0072] The DNA fragment was ligated with the T4 vector and transformed into Escherichia coli. According to the blue-white screening results, several colonies were picked for amplification and culture, and then the plasmid was extracted by gel electrophoresis to check whether the bands were correct and then sent for sequencing.

[0073] 3. Synthesis of RACE Primers

[0074] VG51: GGTAGGCTCCAACAGGTGAAGA

[0075] VG52: TTGATGAGAGTCGGCAGCACG

[0076] VG31: ACTGGAAGCTCTGCGTTGAT...

Embodiment 2

[0090] A qPCR-based method for analyzing the change analysis of the expression profile of the vitellogenin gene of Channa sinensis under hormone induction, the method is realized by the following steps:

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the fields of molecular biology and environmental science, and discloses a bostrychus sinensis vitellogenin full-length gene, a cloning method thereof and an application thereof. A VTG gene sequence is shown as SEQ1 and an amino acid sequence is shown as SEQ2. The bostrychus sinensis vitellogenin full-length gene sensitive to environment changes is firstly obtained, which fills blank of bostrychus sinensis genome, and at the same time, the gene is the VTG gene obtained by inducing aristichthys nobilis under stimulation of E2, therefore, expression of the gene is directly related to stimulation of environmental hormones, gene regulation and protein can better reflect status of environmental hormone pollution, and the gene and protein are more accurate and practical for environmental monitoring and evaluation as biomarkers of environmental estrogens. At the same time, the bostrychus sinensis vitellogenin full-length gene has theoretical and practical significance to further study of expression and application of the VTG protein under action of the environmental hormones.

Description

technical field [0001] The invention relates to the fields of molecular biology and environmental science, and specifically discloses a full-length sequence of a vitellogenin (vtg) gene based on a new model fish along the coast and tidal flats, a cloning method and application thereof. Background technique [0002] In recent years, environmental estrogens (Environmental Estrogens, EEs) have attracted widespread public attention due to their adverse effects on water bodies. Environmental estrogen is a compound that interferes with the synthesis, release, transportation, combination, and metabolism of normal endocrine substances in the body, and interferes with the operation of the body's endocrine system. It can be divided into phthalates, dioxins, bisphenols, and polychlorinated substances. Biphenyls, steroids, etc. Environmental estrogen under natural conditions mainly comes from industrial, agricultural and domestic wastewater, and can cause profound harm to humans or oth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/10C12Q1/6888
CPCC07K14/47C12Q1/6888C12Q2600/158
Inventor 周克夫孟坤
Owner XIAMEN UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More